Mutagenetix > Incidental Mutation

Incidental Mutation 'R7091:Tdp2'

550229

Institutional Source

Beutler Lab

Gene Symbol

Tdp2

Ensembl Gene

ENSMUSG00000035958

Gene Name

tyrosyl-DNA phosphodiesterase 2

Synonyms

D13Ertd656e, Ttrap

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.532) question?

Stock #

R7091 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

24831679-24842153 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 24838224 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 209 (F209I)

Ref Sequence

ENSEMBL: ENSMUSP00000035660 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038039] [ENSMUST00000225138]

AlphaFold

Q9JJX7

PDB Structure

Mus Musculus Tdp2 Bound to dAMP and Mg2+ [X-RAY DIFFRACTION]
Mus Musculus Tdp2-DNA Substrate Analog (5'-6-aminohexanol) Complex [X-RAY DIFFRACTION]
Mus Musculus Tdp2 reaction product (5'-phosphorylated DNA)-Mg2+ complex at 1.5 Angstroms resolution [X-RAY DIFFRACTION]
Mus Musculus Tdp2 excluded ssDNA complex [X-RAY DIFFRACTION]
Mus Musculus Tdp2 reaction product complex with 5'-phosphorylated RNA/DNA, glycerol, and Mg2+ [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000038039
AA Change: F209I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000035660
Gene: ENSMUSG00000035958
AA Change: F209I

Domain	Start	End	E-Value	Type
low complexity region	9	30	N/A	INTRINSIC
Pfam:Exo_endo_phos	127	359	3.9e-20	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000225138

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

98% (56/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a superfamily of divalent cation-dependent phosphodiesterases. The encoded protein associates with CD40, tumor necrosis factor (TNF) receptor-75 and TNF receptor associated factors (TRAFs), and inhibits nuclear factor-kappa-B activation. This protein has sequence and structural similarities with APE1 endonuclease, which is involved in both DNA repair and the activation of transcription factors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice carrying a gene trap insertion into intron 5 but subsequently shown to harbor a partial duplication of the wild-type allele at the ES cell level are born with a normal Mendelian distribution. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130019O22Rik	C	A	7: 127,384,362	A523S	possibly damaging	Het
Abhd18	A	C	3: 40,916,738	I111L	probably damaging	Het
Ank1	A	G	8: 23,058,663	D11G	probably benign	Het
Ank2	G	T	3: 127,023,351	Q472K	probably damaging	Het
Apbb2	A	T	5: 66,313,334	L520H	probably damaging	Het
Baat	T	C	4: 49,499,692	K205E	probably benign	Het
Brca1	T	A	11: 101,526,427	M294L	probably benign	Het
Capn1	A	G	19: 5,991,556	M641T	possibly damaging	Het
Cluap1	T	A	16: 3,940,806	D377E	probably benign	Het
Col6a2	C	T	10: 76,615,091	V39I	unknown	Het
Crybg3	T	A	16: 59,557,168	D1241V	possibly damaging	Het
Dnah10	A	G	5: 124,816,142	K3380R	probably benign	Het
Eml5	T	C	12: 98,802,474	I1400M	probably benign	Het
Fancd2	A	G	6: 113,545,101	D219G	probably damaging	Het
Fras1	A	G	5: 96,708,676	S1973G	probably benign	Het
Fsd1	G	A	17: 55,993,876	R245H	probably damaging	Het
G3bp1	T	A	11: 55,496,221	H271Q	possibly damaging	Het
Glce	A	G	9: 62,060,588	V427A	probably damaging	Het
Gm4778	T	C	3: 94,266,638	F314L	probably damaging	Het
Gm5141	T	C	13: 62,773,964	T464A	possibly damaging	Het
Gulp1	T	A	1: 44,766,134	F128I	probably damaging	Het
H2-Bl	T	C	17: 36,083,941	E30G	possibly damaging	Het
Hcrtr1	A	C	4: 130,130,914	L393W	probably damaging	Het
Heg1	T	C	16: 33,726,720	S650P	probably benign	Het
Hspa4l	T	A	3: 40,781,592	N569K	probably benign	Het
Ifi206	A	G	1: 173,473,875	F746L	unknown	Het
Ivl	T	C	3: 92,572,242	D172G	possibly damaging	Het
Lrp5	A	T	19: 3,630,184	D433E	probably damaging	Het
Mgam	T	C	6: 40,768,276	S1826P	possibly damaging	Het
Ms4a18	A	T	19: 11,008,728	L206M	probably damaging	Het
Msln	A	T	17: 25,750,080	C444S	probably damaging	Het
Mta1	A	G	12: 113,136,402	D644G	probably damaging	Het
Muc5ac	G	C	7: 141,809,687		probably benign	Het
Naa15	T	C	3: 51,458,756		probably null	Het
Nadk	A	G	4: 155,587,758	H302R	probably benign	Het
Neb	T	A	2: 52,256,112	N15I		Het
Nup153	A	T	13: 46,683,928	S1273T	probably benign	Het
Ofcc1	A	G	13: 40,072,767	I763T	probably damaging	Het
Olfr142	T	C	2: 90,252,463	Y175C	probably damaging	Het
Oxsr1	T	C	9: 119,284,661	I107V	probably benign	Het
Prmt5	A	G	14: 54,511,342		probably null	Het
Ptk2	G	A	15: 73,221,809	P854S	possibly damaging	Het
Ranbp6	A	G	19: 29,812,716	S79P	probably damaging	Het
Reln	T	C	5: 21,899,029	I3315V	probably null	Het
Rnf223	T	C	4: 156,132,699	V177A	probably benign	Het
Slc20a1	C	T	2: 129,208,272	T450M	possibly damaging	Het
Smg5	C	T	3: 88,351,347	P542S	probably benign	Het
Sorl1	T	A	9: 42,002,634	Q1333L	probably benign	Het
Spag5	T	A	11: 78,313,191		probably null	Het
Tgm4	C	A	9: 123,040,460	L35M	probably damaging	Het
Tma7	A	G	9: 109,082,512		probably benign	Het
Tmprss4	A	T	9: 45,184,273	V91D	probably damaging	Het
Tnfsf4	T	A	1: 161,395,697	M39K	probably benign	Het
Ttn	T	A	2: 76,713,568	T33025S	probably benign	Het
Tut1	A	G	19: 8,965,811	H754R	probably benign	Het
Vmn2r27	T	G	6: 124,223,945	Q351P	possibly damaging	Het
Wee2	G	T	6: 40,462,002	G353V	probably benign	Het
Zfp879	T	A	11: 50,833,395	H278L	probably damaging	Het

Other mutations in Tdp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00775:Tdp2	APN	13	24840538	missense	probably damaging	1.00
IGL01376:Tdp2	APN	13	24836949	splice site	probably null
IGL02346:Tdp2	APN	13	24841352	missense	possibly damaging	0.86
IGL02455:Tdp2	APN	13	24841262	missense	probably damaging	0.97
R0008:Tdp2	UTSW	13	24841350	splice site	probably null
R0008:Tdp2	UTSW	13	24841350	splice site	probably null
R0164:Tdp2	UTSW	13	24838239	missense	probably damaging	1.00
R0164:Tdp2	UTSW	13	24838239	missense	probably damaging	1.00
R0179:Tdp2	UTSW	13	24840448	missense	possibly damaging	0.46
R1939:Tdp2	UTSW	13	24841277	missense	probably benign	0.07
R3807:Tdp2	UTSW	13	24831793	nonsense	probably null
R3955:Tdp2	UTSW	13	24836099	missense	probably benign	0.00
R4943:Tdp2	UTSW	13	24838265	missense	probably benign	0.02
R5044:Tdp2	UTSW	13	24831826	missense	probably benign	0.00
R5529:Tdp2	UTSW	13	24838236	nonsense	probably null
R5827:Tdp2	UTSW	13	24831853	missense	probably damaging	0.99
R6235:Tdp2	UTSW	13	24840395	nonsense	probably null
R6326:Tdp2	UTSW	13	24840557	missense	probably damaging	1.00
R7244:Tdp2	UTSW	13	24841301	missense	probably benign	0.02
R7341:Tdp2	UTSW	13	24832076	missense	probably benign	0.00
R8010:Tdp2	UTSW	13	24836027	missense	probably damaging	1.00
R9203:Tdp2	UTSW	13	24836933	nonsense	probably null
Z1177:Tdp2	UTSW	13	24841251	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CGAACTCAGAAATCCGCCTG -3'
(R):5'- TTCTGAGTTCAAGGCCAGCC -3'

Sequencing Primer
(F):5'- TTAAAGGCGTGTGTACCACC -3'
(R):5'- CCTGGTCTACAAAGTGAGTTCCAG -3'

Posted On

2019-05-15