Mutagenetix > Incidental Mutation

Incidental Mutation 'R7091:Nup153'

550231

Institutional Source

Beutler Lab

Gene Symbol

Nup153

Ensembl Gene

ENSMUSG00000021374

Gene Name

nucleoporin 153

Synonyms

B130015D15Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.942) question?

Stock #

R7091 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

46679905-46727940 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 46683928 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 1273 (S1273T)

Ref Sequence

ENSEMBL: ENSMUSP00000021803 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021803]

AlphaFold

E9Q3G8

Predicted Effect

probably benign
Transcript: ENSMUST00000021803
AA Change: S1273T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000021803
Gene: ENSMUSG00000021374
AA Change: S1273T

Domain	Start	End	E-Value	Type
low complexity region	6	15	N/A	INTRINSIC
Pfam:Nup153	114	627	6e-236	PFAM
ZnF_RBZ	656	680	6.56e-6	SMART
ZnF_RBZ	719	743	5.89e-8	SMART
low complexity region	756	775	N/A	INTRINSIC
ZnF_RBZ	787	811	7.2e-3	SMART
low complexity region	815	830	N/A	INTRINSIC
ZnF_RBZ	844	868	1.64e-6	SMART
low complexity region	898	911	N/A	INTRINSIC
low complexity region	1078	1085	N/A	INTRINSIC
low complexity region	1183	1207	N/A	INTRINSIC
low complexity region	1248	1260	N/A	INTRINSIC
low complexity region	1271	1296	N/A	INTRINSIC
Pfam:Nup_retrotrp_bd	1372	1462	4.4e-24	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000224203

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

98% (56/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nuclear pore complexes regulate the transport of macromolecules between the nucleus and cytoplasm. They are composed of at least 100 different polypeptide subunits, many of which belong to the nucleoporin family. Nucleoporins are glycoproteins found in nuclear pores and contain characteristic pentapeptide XFXFG repeats as well as O-linked N-acetylglucosamine residues oriented towards the cytoplasm. The protein encoded by this gene has three distinct domains: a N-terminal region containing a pore targeting and an RNA-binding domain domain, a central region containing multiple zinc finger motifs, and a C-terminal region containing multiple XFXFG repeats. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, May 2013]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130019O22Rik	C	A	7: 127,384,362	A523S	possibly damaging	Het
Abhd18	A	C	3: 40,916,738	I111L	probably damaging	Het
Ank1	A	G	8: 23,058,663	D11G	probably benign	Het
Ank2	G	T	3: 127,023,351	Q472K	probably damaging	Het
Apbb2	A	T	5: 66,313,334	L520H	probably damaging	Het
Baat	T	C	4: 49,499,692	K205E	probably benign	Het
Brca1	T	A	11: 101,526,427	M294L	probably benign	Het
Capn1	A	G	19: 5,991,556	M641T	possibly damaging	Het
Cluap1	T	A	16: 3,940,806	D377E	probably benign	Het
Col6a2	C	T	10: 76,615,091	V39I	unknown	Het
Crybg3	T	A	16: 59,557,168	D1241V	possibly damaging	Het
Dnah10	A	G	5: 124,816,142	K3380R	probably benign	Het
Eml5	T	C	12: 98,802,474	I1400M	probably benign	Het
Fancd2	A	G	6: 113,545,101	D219G	probably damaging	Het
Fras1	A	G	5: 96,708,676	S1973G	probably benign	Het
Fsd1	G	A	17: 55,993,876	R245H	probably damaging	Het
G3bp1	T	A	11: 55,496,221	H271Q	possibly damaging	Het
Glce	A	G	9: 62,060,588	V427A	probably damaging	Het
Gm4778	T	C	3: 94,266,638	F314L	probably damaging	Het
Gm5141	T	C	13: 62,773,964	T464A	possibly damaging	Het
Gulp1	T	A	1: 44,766,134	F128I	probably damaging	Het
H2-Bl	T	C	17: 36,083,941	E30G	possibly damaging	Het
Hcrtr1	A	C	4: 130,130,914	L393W	probably damaging	Het
Heg1	T	C	16: 33,726,720	S650P	probably benign	Het
Hspa4l	T	A	3: 40,781,592	N569K	probably benign	Het
Ifi206	A	G	1: 173,473,875	F746L	unknown	Het
Ivl	T	C	3: 92,572,242	D172G	possibly damaging	Het
Lrp5	A	T	19: 3,630,184	D433E	probably damaging	Het
Mgam	T	C	6: 40,768,276	S1826P	possibly damaging	Het
Ms4a18	A	T	19: 11,008,728	L206M	probably damaging	Het
Msln	A	T	17: 25,750,080	C444S	probably damaging	Het
Mta1	A	G	12: 113,136,402	D644G	probably damaging	Het
Muc5ac	G	C	7: 141,809,687		probably benign	Het
Naa15	T	C	3: 51,458,756		probably null	Het
Nadk	A	G	4: 155,587,758	H302R	probably benign	Het
Neb	T	A	2: 52,256,112	N15I		Het
Ofcc1	A	G	13: 40,072,767	I763T	probably damaging	Het
Olfr142	T	C	2: 90,252,463	Y175C	probably damaging	Het
Oxsr1	T	C	9: 119,284,661	I107V	probably benign	Het
Prmt5	A	G	14: 54,511,342		probably null	Het
Ptk2	G	A	15: 73,221,809	P854S	possibly damaging	Het
Ranbp6	A	G	19: 29,812,716	S79P	probably damaging	Het
Reln	T	C	5: 21,899,029	I3315V	probably null	Het
Rnf223	T	C	4: 156,132,699	V177A	probably benign	Het
Slc20a1	C	T	2: 129,208,272	T450M	possibly damaging	Het
Smg5	C	T	3: 88,351,347	P542S	probably benign	Het
Sorl1	T	A	9: 42,002,634	Q1333L	probably benign	Het
Spag5	T	A	11: 78,313,191		probably null	Het
Tdp2	T	A	13: 24,838,224	F209I	probably damaging	Het
Tgm4	C	A	9: 123,040,460	L35M	probably damaging	Het
Tma7	A	G	9: 109,082,512		probably benign	Het
Tmprss4	A	T	9: 45,184,273	V91D	probably damaging	Het
Tnfsf4	T	A	1: 161,395,697	M39K	probably benign	Het
Ttn	T	A	2: 76,713,568	T33025S	probably benign	Het
Tut1	A	G	19: 8,965,811	H754R	probably benign	Het
Vmn2r27	T	G	6: 124,223,945	Q351P	possibly damaging	Het
Wee2	G	T	6: 40,462,002	G353V	probably benign	Het
Zfp879	T	A	11: 50,833,395	H278L	probably damaging	Het

Other mutations in Nup153

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00657:Nup153	APN	13	46681150	unclassified	probably benign
IGL01312:Nup153	APN	13	46686824	missense	probably benign	0.03
IGL01459:Nup153	APN	13	46712926	missense	possibly damaging	0.84
IGL01646:Nup153	APN	13	46684107	missense	possibly damaging	0.80
IGL03064:Nup153	APN	13	46693839	missense	probably benign
IGL03288:Nup153	APN	13	46705205	missense	possibly damaging	0.71
IGL03369:Nup153	APN	13	46700983	splice site	probably null
IGL03371:Nup153	APN	13	46683152	missense	probably benign	0.34
R0193:Nup153	UTSW	13	46709654	missense	probably benign	0.01
R0244:Nup153	UTSW	13	46693936	missense	probably benign	0.03
R0448:Nup153	UTSW	13	46717181	missense	probably benign	0.00
R0943:Nup153	UTSW	13	46696772	splice site	probably benign
R1219:Nup153	UTSW	13	46687219	missense	probably benign	0.01
R1381:Nup153	UTSW	13	46689181	missense	probably damaging	1.00
R1709:Nup153	UTSW	13	46693974	missense	probably damaging	1.00
R1727:Nup153	UTSW	13	46693785	missense	probably damaging	1.00
R1818:Nup153	UTSW	13	46681637	missense	possibly damaging	0.94
R1824:Nup153	UTSW	13	46713747	missense	probably damaging	1.00
R1928:Nup153	UTSW	13	46701026	missense	probably damaging	0.98
R2108:Nup153	UTSW	13	46693510	critical splice donor site	probably null
R2110:Nup153	UTSW	13	46683928	missense	probably benign	0.00
R2111:Nup153	UTSW	13	46683928	missense	probably benign	0.00
R2173:Nup153	UTSW	13	46701600	splice site	probably benign
R2231:Nup153	UTSW	13	46709627	critical splice donor site	probably null
R3879:Nup153	UTSW	13	46683960	missense	probably damaging	1.00
R4634:Nup153	UTSW	13	46687230	missense	possibly damaging	0.49
R4662:Nup153	UTSW	13	46687274	missense	possibly damaging	0.68
R4932:Nup153	UTSW	13	46712737	nonsense	probably null
R5011:Nup153	UTSW	13	46687403	missense	possibly damaging	0.62
R5023:Nup153	UTSW	13	46681109	unclassified	probably benign
R5069:Nup153	UTSW	13	46709792	missense	probably benign	0.05
R5137:Nup153	UTSW	13	46684153	missense	probably damaging	0.99
R5323:Nup153	UTSW	13	46717206	missense	probably benign	0.19
R5345:Nup153	UTSW	13	46686865	nonsense	probably null
R5536:Nup153	UTSW	13	46683009	missense	probably benign	0.01
R5613:Nup153	UTSW	13	46687271	missense	possibly damaging	0.64
R5620:Nup153	UTSW	13	46684006	nonsense	probably null
R5764:Nup153	UTSW	13	46687327	missense	probably damaging	0.97
R5849:Nup153	UTSW	13	46686976	missense	probably damaging	0.99
R6454:Nup153	UTSW	13	46709660	splice site	probably null
R6701:Nup153	UTSW	13	46687065	missense	probably benign	0.00
R6721:Nup153	UTSW	13	46701026	missense	probably damaging	0.98
R6737:Nup153	UTSW	13	46689206	missense	probably benign	0.08
R6789:Nup153	UTSW	13	46717316	missense	probably damaging	1.00
R6820:Nup153	UTSW	13	46709983	missense	probably benign	0.09
R6837:Nup153	UTSW	13	46694051	missense	probably damaging	1.00
R6913:Nup153	UTSW	13	46699716	missense	probably damaging	1.00
R7052:Nup153	UTSW	13	46687473	missense	probably benign	0.09
R7357:Nup153	UTSW	13	46717166	missense	probably benign	0.32
R7389:Nup153	UTSW	13	46700987	critical splice donor site	probably null
R7423:Nup153	UTSW	13	46696644	critical splice donor site	probably null
R7453:Nup153	UTSW	13	46681181	missense	probably damaging	1.00
R7611:Nup153	UTSW	13	46687322	missense	probably benign	0.01
R7876:Nup153	UTSW	13	46681608	missense	probably benign
R7909:Nup153	UTSW	13	46693580	missense	probably damaging	1.00
R7938:Nup153	UTSW	13	46689379	splice site	probably null
R8735:Nup153	UTSW	13	46727551	start gained	probably benign
R8804:Nup153	UTSW	13	46687159	missense	probably benign	0.04
R8916:Nup153	UTSW	13	46709986	nonsense	probably null
R9025:Nup153	UTSW	13	46684233	missense	probably benign	0.36
R9217:Nup153	UTSW	13	46681662	missense	probably damaging	1.00
R9390:Nup153	UTSW	13	46687166	missense	probably damaging	1.00
R9701:Nup153	UTSW	13	46686735	missense	probably benign	0.01
R9714:Nup153	UTSW	13	46712959	missense	possibly damaging	0.55

Predicted Primers

PCR Primer
(F):5'- ATCTATTCCACCTGAAGTGCCC -3'
(R):5'- GCACCAGCCACTTCATCTAG -3'

Sequencing Primer
(F):5'- GAAGTGCCCATTTTTCCACAGGTG -3'
(R):5'- ACCTGTGGCAGCCTTTG -3'

Posted On

2019-05-15