Incidental Mutation 'R7091:Nup153'
ID 550231
Institutional Source Beutler Lab
Gene Symbol Nup153
Ensembl Gene ENSMUSG00000021374
Gene Name nucleoporin 153
Synonyms B130015D15Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.942) question?
Stock # R7091 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 46679905-46727940 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 46683928 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 1273 (S1273T)
Ref Sequence ENSEMBL: ENSMUSP00000021803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021803]
AlphaFold E9Q3G8
Predicted Effect probably benign
Transcript: ENSMUST00000021803
AA Change: S1273T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021803
Gene: ENSMUSG00000021374
AA Change: S1273T

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
Pfam:Nup153 114 627 6e-236 PFAM
ZnF_RBZ 656 680 6.56e-6 SMART
ZnF_RBZ 719 743 5.89e-8 SMART
low complexity region 756 775 N/A INTRINSIC
ZnF_RBZ 787 811 7.2e-3 SMART
low complexity region 815 830 N/A INTRINSIC
ZnF_RBZ 844 868 1.64e-6 SMART
low complexity region 898 911 N/A INTRINSIC
low complexity region 1078 1085 N/A INTRINSIC
low complexity region 1183 1207 N/A INTRINSIC
low complexity region 1248 1260 N/A INTRINSIC
low complexity region 1271 1296 N/A INTRINSIC
Pfam:Nup_retrotrp_bd 1372 1462 4.4e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224203
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nuclear pore complexes regulate the transport of macromolecules between the nucleus and cytoplasm. They are composed of at least 100 different polypeptide subunits, many of which belong to the nucleoporin family. Nucleoporins are glycoproteins found in nuclear pores and contain characteristic pentapeptide XFXFG repeats as well as O-linked N-acetylglucosamine residues oriented towards the cytoplasm. The protein encoded by this gene has three distinct domains: a N-terminal region containing a pore targeting and an RNA-binding domain domain, a central region containing multiple zinc finger motifs, and a C-terminal region containing multiple XFXFG repeats. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik C A 7: 127,384,362 A523S possibly damaging Het
Abhd18 A C 3: 40,916,738 I111L probably damaging Het
Ank1 A G 8: 23,058,663 D11G probably benign Het
Ank2 G T 3: 127,023,351 Q472K probably damaging Het
Apbb2 A T 5: 66,313,334 L520H probably damaging Het
Baat T C 4: 49,499,692 K205E probably benign Het
Brca1 T A 11: 101,526,427 M294L probably benign Het
Capn1 A G 19: 5,991,556 M641T possibly damaging Het
Cluap1 T A 16: 3,940,806 D377E probably benign Het
Col6a2 C T 10: 76,615,091 V39I unknown Het
Crybg3 T A 16: 59,557,168 D1241V possibly damaging Het
Dnah10 A G 5: 124,816,142 K3380R probably benign Het
Eml5 T C 12: 98,802,474 I1400M probably benign Het
Fancd2 A G 6: 113,545,101 D219G probably damaging Het
Fras1 A G 5: 96,708,676 S1973G probably benign Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
G3bp1 T A 11: 55,496,221 H271Q possibly damaging Het
Glce A G 9: 62,060,588 V427A probably damaging Het
Gm4778 T C 3: 94,266,638 F314L probably damaging Het
Gm5141 T C 13: 62,773,964 T464A possibly damaging Het
Gulp1 T A 1: 44,766,134 F128I probably damaging Het
H2-Bl T C 17: 36,083,941 E30G possibly damaging Het
Hcrtr1 A C 4: 130,130,914 L393W probably damaging Het
Heg1 T C 16: 33,726,720 S650P probably benign Het
Hspa4l T A 3: 40,781,592 N569K probably benign Het
Ifi206 A G 1: 173,473,875 F746L unknown Het
Ivl T C 3: 92,572,242 D172G possibly damaging Het
Lrp5 A T 19: 3,630,184 D433E probably damaging Het
Mgam T C 6: 40,768,276 S1826P possibly damaging Het
Ms4a18 A T 19: 11,008,728 L206M probably damaging Het
Msln A T 17: 25,750,080 C444S probably damaging Het
Mta1 A G 12: 113,136,402 D644G probably damaging Het
Muc5ac G C 7: 141,809,687 probably benign Het
Naa15 T C 3: 51,458,756 probably null Het
Nadk A G 4: 155,587,758 H302R probably benign Het
Neb T A 2: 52,256,112 N15I Het
Ofcc1 A G 13: 40,072,767 I763T probably damaging Het
Olfr142 T C 2: 90,252,463 Y175C probably damaging Het
Oxsr1 T C 9: 119,284,661 I107V probably benign Het
Prmt5 A G 14: 54,511,342 probably null Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Ranbp6 A G 19: 29,812,716 S79P probably damaging Het
Reln T C 5: 21,899,029 I3315V probably null Het
Rnf223 T C 4: 156,132,699 V177A probably benign Het
Slc20a1 C T 2: 129,208,272 T450M possibly damaging Het
Smg5 C T 3: 88,351,347 P542S probably benign Het
Sorl1 T A 9: 42,002,634 Q1333L probably benign Het
Spag5 T A 11: 78,313,191 probably null Het
Tdp2 T A 13: 24,838,224 F209I probably damaging Het
Tgm4 C A 9: 123,040,460 L35M probably damaging Het
Tma7 A G 9: 109,082,512 probably benign Het
Tmprss4 A T 9: 45,184,273 V91D probably damaging Het
Tnfsf4 T A 1: 161,395,697 M39K probably benign Het
Ttn T A 2: 76,713,568 T33025S probably benign Het
Tut1 A G 19: 8,965,811 H754R probably benign Het
Vmn2r27 T G 6: 124,223,945 Q351P possibly damaging Het
Wee2 G T 6: 40,462,002 G353V probably benign Het
Zfp879 T A 11: 50,833,395 H278L probably damaging Het
Other mutations in Nup153
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00657:Nup153 APN 13 46681150 unclassified probably benign
IGL01312:Nup153 APN 13 46686824 missense probably benign 0.03
IGL01459:Nup153 APN 13 46712926 missense possibly damaging 0.84
IGL01646:Nup153 APN 13 46684107 missense possibly damaging 0.80
IGL03064:Nup153 APN 13 46693839 missense probably benign
IGL03288:Nup153 APN 13 46705205 missense possibly damaging 0.71
IGL03369:Nup153 APN 13 46700983 splice site probably null
IGL03371:Nup153 APN 13 46683152 missense probably benign 0.34
R0193:Nup153 UTSW 13 46709654 missense probably benign 0.01
R0244:Nup153 UTSW 13 46693936 missense probably benign 0.03
R0448:Nup153 UTSW 13 46717181 missense probably benign 0.00
R0943:Nup153 UTSW 13 46696772 splice site probably benign
R1219:Nup153 UTSW 13 46687219 missense probably benign 0.01
R1381:Nup153 UTSW 13 46689181 missense probably damaging 1.00
R1709:Nup153 UTSW 13 46693974 missense probably damaging 1.00
R1727:Nup153 UTSW 13 46693785 missense probably damaging 1.00
R1818:Nup153 UTSW 13 46681637 missense possibly damaging 0.94
R1824:Nup153 UTSW 13 46713747 missense probably damaging 1.00
R1928:Nup153 UTSW 13 46701026 missense probably damaging 0.98
R2108:Nup153 UTSW 13 46693510 critical splice donor site probably null
R2110:Nup153 UTSW 13 46683928 missense probably benign 0.00
R2111:Nup153 UTSW 13 46683928 missense probably benign 0.00
R2173:Nup153 UTSW 13 46701600 splice site probably benign
R2231:Nup153 UTSW 13 46709627 critical splice donor site probably null
R3879:Nup153 UTSW 13 46683960 missense probably damaging 1.00
R4634:Nup153 UTSW 13 46687230 missense possibly damaging 0.49
R4662:Nup153 UTSW 13 46687274 missense possibly damaging 0.68
R4932:Nup153 UTSW 13 46712737 nonsense probably null
R5011:Nup153 UTSW 13 46687403 missense possibly damaging 0.62
R5023:Nup153 UTSW 13 46681109 unclassified probably benign
R5069:Nup153 UTSW 13 46709792 missense probably benign 0.05
R5137:Nup153 UTSW 13 46684153 missense probably damaging 0.99
R5323:Nup153 UTSW 13 46717206 missense probably benign 0.19
R5345:Nup153 UTSW 13 46686865 nonsense probably null
R5536:Nup153 UTSW 13 46683009 missense probably benign 0.01
R5613:Nup153 UTSW 13 46687271 missense possibly damaging 0.64
R5620:Nup153 UTSW 13 46684006 nonsense probably null
R5764:Nup153 UTSW 13 46687327 missense probably damaging 0.97
R5849:Nup153 UTSW 13 46686976 missense probably damaging 0.99
R6454:Nup153 UTSW 13 46709660 splice site probably null
R6701:Nup153 UTSW 13 46687065 missense probably benign 0.00
R6721:Nup153 UTSW 13 46701026 missense probably damaging 0.98
R6737:Nup153 UTSW 13 46689206 missense probably benign 0.08
R6789:Nup153 UTSW 13 46717316 missense probably damaging 1.00
R6820:Nup153 UTSW 13 46709983 missense probably benign 0.09
R6837:Nup153 UTSW 13 46694051 missense probably damaging 1.00
R6913:Nup153 UTSW 13 46699716 missense probably damaging 1.00
R7052:Nup153 UTSW 13 46687473 missense probably benign 0.09
R7357:Nup153 UTSW 13 46717166 missense probably benign 0.32
R7389:Nup153 UTSW 13 46700987 critical splice donor site probably null
R7423:Nup153 UTSW 13 46696644 critical splice donor site probably null
R7453:Nup153 UTSW 13 46681181 missense probably damaging 1.00
R7611:Nup153 UTSW 13 46687322 missense probably benign 0.01
R7876:Nup153 UTSW 13 46681608 missense probably benign
R7909:Nup153 UTSW 13 46693580 missense probably damaging 1.00
R7938:Nup153 UTSW 13 46689379 splice site probably null
R8735:Nup153 UTSW 13 46727551 start gained probably benign
R8804:Nup153 UTSW 13 46687159 missense probably benign 0.04
R8916:Nup153 UTSW 13 46709986 nonsense probably null
R9025:Nup153 UTSW 13 46684233 missense probably benign 0.36
R9217:Nup153 UTSW 13 46681662 missense probably damaging 1.00
R9390:Nup153 UTSW 13 46687166 missense probably damaging 1.00
R9701:Nup153 UTSW 13 46686735 missense probably benign 0.01
R9714:Nup153 UTSW 13 46712959 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- ATCTATTCCACCTGAAGTGCCC -3'
(R):5'- GCACCAGCCACTTCATCTAG -3'

Sequencing Primer
(F):5'- GAAGTGCCCATTTTTCCACAGGTG -3'
(R):5'- ACCTGTGGCAGCCTTTG -3'
Posted On 2019-05-15