Incidental Mutation 'R7091:Ptk2'
ID 550233
Institutional Source Beutler Lab
Gene Symbol Ptk2
Ensembl Gene ENSMUSG00000022607
Gene Name PTK2 protein tyrosine kinase 2
Synonyms FRNK, FAK, Fadk
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7091 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 73205102-73423280 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 73221809 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 854 (P854S)
Ref Sequence ENSEMBL: ENSMUSP00000105663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110036] [ENSMUST00000226988]
AlphaFold P34152
Predicted Effect possibly damaging
Transcript: ENSMUST00000110036
AA Change: P854S

PolyPhen 2 Score 0.459 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105663
Gene: ENSMUSG00000022607
AA Change: P854S

DomainStartEndE-ValueType
B41 31 258 1.49e-39 SMART
Blast:B41 288 333 1e-19 BLAST
TyrKc 422 676 1.11e-130 SMART
low complexity region 686 698 N/A INTRINSIC
low complexity region 712 726 N/A INTRINSIC
low complexity region 863 883 N/A INTRINSIC
Pfam:Focal_AT 914 1046 5e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226988
AA Change: P854S

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
Meta Mutation Damage Score 0.0739 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein tyrosine kinase which is found concentrated in the focal adhesions that form between cells growing in the presence of extracellular matrix constituents. The encoded protein is a member of the FAK subfamily of protein tyrosine kinases but lacks significant sequence similarity to kinases from other subfamilies. Activation of this gene may be an important early step in cell growth and intracellular signal transduction pathways triggered in response to certain neural peptides or to cell interactions with the extracellular matrix. Several transcript variants encoding different isoforms have been found for this gene, but the full-length natures of only four of them have been determined. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele die before or during organogenesis with growth retardation, abnormal embryonic and extra embryonic tissue development, and abnormal vascular development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik C A 7: 127,384,362 A523S possibly damaging Het
Abhd18 A C 3: 40,916,738 I111L probably damaging Het
Ank1 A G 8: 23,058,663 D11G probably benign Het
Ank2 G T 3: 127,023,351 Q472K probably damaging Het
Apbb2 A T 5: 66,313,334 L520H probably damaging Het
Baat T C 4: 49,499,692 K205E probably benign Het
Brca1 T A 11: 101,526,427 M294L probably benign Het
Capn1 A G 19: 5,991,556 M641T possibly damaging Het
Cluap1 T A 16: 3,940,806 D377E probably benign Het
Col6a2 C T 10: 76,615,091 V39I unknown Het
Crybg3 T A 16: 59,557,168 D1241V possibly damaging Het
Dnah10 A G 5: 124,816,142 K3380R probably benign Het
Eml5 T C 12: 98,802,474 I1400M probably benign Het
Fancd2 A G 6: 113,545,101 D219G probably damaging Het
Fras1 A G 5: 96,708,676 S1973G probably benign Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
G3bp1 T A 11: 55,496,221 H271Q possibly damaging Het
Glce A G 9: 62,060,588 V427A probably damaging Het
Gm4778 T C 3: 94,266,638 F314L probably damaging Het
Gm5141 T C 13: 62,773,964 T464A possibly damaging Het
Gulp1 T A 1: 44,766,134 F128I probably damaging Het
H2-Bl T C 17: 36,083,941 E30G possibly damaging Het
Hcrtr1 A C 4: 130,130,914 L393W probably damaging Het
Heg1 T C 16: 33,726,720 S650P probably benign Het
Hspa4l T A 3: 40,781,592 N569K probably benign Het
Ifi206 A G 1: 173,473,875 F746L unknown Het
Ivl T C 3: 92,572,242 D172G possibly damaging Het
Lrp5 A T 19: 3,630,184 D433E probably damaging Het
Mgam T C 6: 40,768,276 S1826P possibly damaging Het
Ms4a18 A T 19: 11,008,728 L206M probably damaging Het
Msln A T 17: 25,750,080 C444S probably damaging Het
Mta1 A G 12: 113,136,402 D644G probably damaging Het
Muc5ac G C 7: 141,809,687 probably benign Het
Naa15 T C 3: 51,458,756 probably null Het
Nadk A G 4: 155,587,758 H302R probably benign Het
Neb T A 2: 52,256,112 N15I Het
Nup153 A T 13: 46,683,928 S1273T probably benign Het
Ofcc1 A G 13: 40,072,767 I763T probably damaging Het
Olfr142 T C 2: 90,252,463 Y175C probably damaging Het
Oxsr1 T C 9: 119,284,661 I107V probably benign Het
Prmt5 A G 14: 54,511,342 probably null Het
Ranbp6 A G 19: 29,812,716 S79P probably damaging Het
Reln T C 5: 21,899,029 I3315V probably null Het
Rnf223 T C 4: 156,132,699 V177A probably benign Het
Slc20a1 C T 2: 129,208,272 T450M possibly damaging Het
Smg5 C T 3: 88,351,347 P542S probably benign Het
Sorl1 T A 9: 42,002,634 Q1333L probably benign Het
Spag5 T A 11: 78,313,191 probably null Het
Tdp2 T A 13: 24,838,224 F209I probably damaging Het
Tgm4 C A 9: 123,040,460 L35M probably damaging Het
Tma7 A G 9: 109,082,512 probably benign Het
Tmprss4 A T 9: 45,184,273 V91D probably damaging Het
Tnfsf4 T A 1: 161,395,697 M39K probably benign Het
Ttn T A 2: 76,713,568 T33025S probably benign Het
Tut1 A G 19: 8,965,811 H754R probably benign Het
Vmn2r27 T G 6: 124,223,945 Q351P possibly damaging Het
Wee2 G T 6: 40,462,002 G353V probably benign Het
Zfp879 T A 11: 50,833,395 H278L probably damaging Het
Other mutations in Ptk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Ptk2 APN 15 73262547 missense probably damaging 1.00
IGL00913:Ptk2 APN 15 73295389 splice site probably benign
IGL01605:Ptk2 APN 15 73264339 splice site probably benign
IGL01631:Ptk2 APN 15 73216371 missense probably damaging 1.00
IGL01952:Ptk2 APN 15 73229931 missense probably damaging 0.99
IGL01957:Ptk2 APN 15 73242473 missense probably benign 0.05
IGL02441:Ptk2 APN 15 73320826 missense probably benign 0.16
IGL02471:Ptk2 APN 15 73298187 missense probably benign 0.41
IGL02621:Ptk2 APN 15 73206145 missense probably damaging 0.99
IGL03198:Ptk2 APN 15 73236216 missense probably damaging 1.00
Shooter UTSW 15 73304444 missense possibly damaging 0.83
R0239:Ptk2 UTSW 15 73343283 splice site probably null
R0239:Ptk2 UTSW 15 73343283 splice site probably null
R1254:Ptk2 UTSW 15 73229970 missense probably benign 0.01
R1291:Ptk2 UTSW 15 73210756 missense probably damaging 1.00
R1307:Ptk2 UTSW 15 73292046 missense probably benign 0.01
R1608:Ptk2 UTSW 15 73262575 missense probably damaging 0.98
R1690:Ptk2 UTSW 15 73262610 missense probably damaging 1.00
R1724:Ptk2 UTSW 15 73242406 missense possibly damaging 0.58
R1725:Ptk2 UTSW 15 73242406 missense possibly damaging 0.58
R1740:Ptk2 UTSW 15 73242406 missense possibly damaging 0.58
R1741:Ptk2 UTSW 15 73242406 missense possibly damaging 0.58
R1840:Ptk2 UTSW 15 73210884 missense probably damaging 1.00
R1956:Ptk2 UTSW 15 73215983 missense possibly damaging 0.49
R2022:Ptk2 UTSW 15 73242406 missense possibly damaging 0.58
R2092:Ptk2 UTSW 15 73236191 nonsense probably null
R2114:Ptk2 UTSW 15 73242406 missense possibly damaging 0.58
R2115:Ptk2 UTSW 15 73242406 missense possibly damaging 0.58
R2336:Ptk2 UTSW 15 73266116 missense probably damaging 1.00
R2571:Ptk2 UTSW 15 73231919 missense probably damaging 1.00
R4232:Ptk2 UTSW 15 73309849 missense possibly damaging 0.61
R4245:Ptk2 UTSW 15 73231976 missense probably benign 0.00
R4594:Ptk2 UTSW 15 73206196 missense probably damaging 1.00
R4688:Ptk2 UTSW 15 73206225 missense probably damaging 1.00
R4834:Ptk2 UTSW 15 73216096 splice site probably null
R4847:Ptk2 UTSW 15 73231956 missense probably benign
R5558:Ptk2 UTSW 15 73304445 missense probably damaging 0.97
R5682:Ptk2 UTSW 15 73262564 nonsense probably null
R5858:Ptk2 UTSW 15 73321095 missense probably benign 0.12
R5951:Ptk2 UTSW 15 73303833 missense possibly damaging 0.88
R6014:Ptk2 UTSW 15 73304444 missense possibly damaging 0.83
R6027:Ptk2 UTSW 15 73229913 missense probably damaging 1.00
R6082:Ptk2 UTSW 15 73276865 missense probably damaging 1.00
R7025:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7031:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7032:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7077:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7078:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7079:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7090:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7092:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7136:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7137:Ptk2 UTSW 15 73221809 missense possibly damaging 0.46
R7798:Ptk2 UTSW 15 73295375 missense probably damaging 1.00
R8057:Ptk2 UTSW 15 73298199 frame shift probably null
R8235:Ptk2 UTSW 15 73343291 missense probably benign 0.00
R9106:Ptk2 UTSW 15 73259608 missense possibly damaging 0.95
R9160:Ptk2 UTSW 15 73216084 missense probably benign 0.01
R9301:Ptk2 UTSW 15 73274497 missense probably damaging 1.00
R9448:Ptk2 UTSW 15 73343192 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- GGACAGTGATCTGCATCTATGAAAATC -3'
(R):5'- TTGGGAGCAGTGTCACAGTG -3'

Sequencing Primer
(F):5'- GCATCTATGAAAATCTGGAACATGGC -3'
(R):5'- ACACTGAGATGATGTTGGGTAC -3'
Posted On 2019-05-15