Incidental Mutation 'R7091:Cluap1'
ID550234
Institutional Source Beutler Lab
Gene Symbol Cluap1
Ensembl Gene ENSMUSG00000014232
Gene Nameclusterin associated protein 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7091 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location3908801-3941147 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 3940806 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 377 (D377E)
Ref Sequence ENSEMBL: ENSMUSP00000043397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040881] [ENSMUST00000177551] [ENSMUST00000180200]
Predicted Effect probably benign
Transcript: ENSMUST00000040881
AA Change: D377E

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000043397
Gene: ENSMUSG00000014232
AA Change: D377E

DomainStartEndE-ValueType
Pfam:Cluap1 14 283 2.5e-121 PFAM
low complexity region 297 307 N/A INTRINSIC
low complexity region 310 330 N/A INTRINSIC
low complexity region 360 388 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177551
SMART Domains Protein: ENSMUSP00000137628
Gene: ENSMUSG00000049871

DomainStartEndE-ValueType
Pfam:NACHT 176 342 2e-34 PFAM
LRR 702 729 3.11e-2 SMART
LRR 730 757 2.27e-4 SMART
LRR 758 785 8.15e-1 SMART
LRR 786 813 2.17e-1 SMART
LRR 814 841 2.12e-4 SMART
LRR 842 869 3.42e0 SMART
LRR 870 897 7.67e-2 SMART
LRR 898 925 3.21e0 SMART
LRR 926 953 1.67e0 SMART
LRR 954 981 4.87e-4 SMART
LRR 982 1009 4.3e0 SMART
LRR 1010 1037 3.8e-6 SMART
LRR 1038 1065 4.47e-3 SMART
LRR 1066 1093 1.08e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000180200
SMART Domains Protein: ENSMUSP00000137325
Gene: ENSMUSG00000049871

DomainStartEndE-ValueType
LRR 4 24 8.65e1 SMART
LRR 25 52 2.27e-4 SMART
LRR 53 80 8.15e-1 SMART
LRR 81 108 2.17e-1 SMART
LRR 109 136 2.12e-4 SMART
LRR 137 164 3.42e0 SMART
LRR 165 192 7.67e-2 SMART
LRR 193 220 3.21e0 SMART
LRR 221 248 1.67e0 SMART
LRR 249 276 4.87e-4 SMART
LRR 277 304 4.3e0 SMART
LRR 305 332 3.8e-6 SMART
LRR 333 360 4.47e-3 SMART
LRR 361 388 1.08e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a single coiled-coil region. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous mutant mice exhibit mid-gestation lethality, failure of embryonic turning, enlarged pericardial sacs, neural tube defects and lack primary cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik C A 7: 127,384,362 A523S possibly damaging Het
Abhd18 A C 3: 40,916,738 I111L probably damaging Het
Ank1 A G 8: 23,058,663 D11G probably benign Het
Ank2 G T 3: 127,023,351 Q472K probably damaging Het
Apbb2 A T 5: 66,313,334 L520H probably damaging Het
Baat T C 4: 49,499,692 K205E probably benign Het
Brca1 T A 11: 101,526,427 M294L probably benign Het
Capn1 A G 19: 5,991,556 M641T possibly damaging Het
Col6a2 C T 10: 76,615,091 V39I unknown Het
Crybg3 T A 16: 59,557,168 D1241V possibly damaging Het
Dnah10 A G 5: 124,816,142 K3380R probably benign Het
Eml5 T C 12: 98,802,474 I1400M probably benign Het
Fancd2 A G 6: 113,545,101 D219G probably damaging Het
Fras1 A G 5: 96,708,676 S1973G probably benign Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
G3bp1 T A 11: 55,496,221 H271Q possibly damaging Het
Glce A G 9: 62,060,588 V427A probably damaging Het
Gm4778 T C 3: 94,266,638 F314L probably damaging Het
Gm5141 T C 13: 62,773,964 T464A possibly damaging Het
Gulp1 T A 1: 44,766,134 F128I probably damaging Het
H2-Bl T C 17: 36,083,941 E30G possibly damaging Het
Hcrtr1 A C 4: 130,130,914 L393W probably damaging Het
Heg1 T C 16: 33,726,720 S650P probably benign Het
Hspa4l T A 3: 40,781,592 N569K probably benign Het
Ifi206 A G 1: 173,473,875 F746L unknown Het
Ivl T C 3: 92,572,242 D172G possibly damaging Het
Lrp5 A T 19: 3,630,184 D433E probably damaging Het
Mgam T C 6: 40,768,276 S1826P possibly damaging Het
Ms4a18 A T 19: 11,008,728 L206M probably damaging Het
Msln A T 17: 25,750,080 C444S probably damaging Het
Mta1 A G 12: 113,136,402 D644G probably damaging Het
Muc5ac G C 7: 141,809,687 probably benign Het
Naa15 T C 3: 51,458,756 probably null Het
Nadk A G 4: 155,587,758 H302R probably benign Het
Neb T A 2: 52,256,112 N15I Het
Nup153 A T 13: 46,683,928 S1273T probably benign Het
Ofcc1 A G 13: 40,072,767 I763T probably damaging Het
Olfr142 T C 2: 90,252,463 Y175C probably damaging Het
Oxsr1 T C 9: 119,284,661 I107V probably benign Het
Prmt5 A G 14: 54,511,342 probably null Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Ranbp6 A G 19: 29,812,716 S79P probably damaging Het
Reln T C 5: 21,899,029 I3315V probably null Het
Rnf223 T C 4: 156,132,699 V177A probably benign Het
Slc20a1 C T 2: 129,208,272 T450M possibly damaging Het
Smg5 C T 3: 88,351,347 P542S probably benign Het
Sorl1 T A 9: 42,002,634 Q1333L probably benign Het
Spag5 T A 11: 78,313,191 probably null Het
Tdp2 T A 13: 24,838,224 F209I probably damaging Het
Tgm4 C A 9: 123,040,460 L35M probably damaging Het
Tma7 A G 9: 109,082,512 probably benign Het
Tmprss4 A T 9: 45,184,273 V91D probably damaging Het
Tnfsf4 T A 1: 161,395,697 M39K probably benign Het
Ttn T A 2: 76,713,568 T33025S probably benign Het
Tut1 A G 19: 8,965,811 H754R probably benign Het
Vmn2r27 T G 6: 124,223,945 Q351P possibly damaging Het
Wee2 G T 6: 40,462,002 G353V probably benign Het
Zfp879 T A 11: 50,833,395 H278L probably damaging Het
Other mutations in Cluap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0304:Cluap1 UTSW 16 3929918 unclassified probably benign
R0545:Cluap1 UTSW 16 3933772 missense probably damaging 0.96
R1459:Cluap1 UTSW 16 3937589 missense probably damaging 1.00
R1511:Cluap1 UTSW 16 3919558 missense probably benign
R2136:Cluap1 UTSW 16 3933772 missense probably damaging 0.96
R3027:Cluap1 UTSW 16 3911532 nonsense probably null
R3926:Cluap1 UTSW 16 3911534 missense probably damaging 0.99
R4386:Cluap1 UTSW 16 3933722 missense possibly damaging 0.70
R4587:Cluap1 UTSW 16 3933816 critical splice donor site probably null
R5587:Cluap1 UTSW 16 3915484 missense probably damaging 1.00
R6010:Cluap1 UTSW 16 3937573 missense possibly damaging 0.91
R6169:Cluap1 UTSW 16 3928561 missense possibly damaging 0.50
R6181:Cluap1 UTSW 16 3933744 missense probably benign
R6194:Cluap1 UTSW 16 3929906 missense probably benign
R6492:Cluap1 UTSW 16 3928612 missense probably benign 0.03
R7131:Cluap1 UTSW 16 3940775 missense probably benign 0.00
R7248:Cluap1 UTSW 16 3919500 missense possibly damaging 0.76
R7421:Cluap1 UTSW 16 3940793 missense probably damaging 0.99
R7719:Cluap1 UTSW 16 3909603 intron probably null
Predicted Primers PCR Primer
(F):5'- CCTCAGGCTAGTGGATTTGTTC -3'
(R):5'- AACACATGTTACCTTTCCAGCC -3'

Sequencing Primer
(F):5'- ATTTGTTCAGCTAGCAATGTGC -3'
(R):5'- CTGCCGAGTCCCTGTGTAC -3'
Posted On2019-05-15