Incidental Mutation 'R7091:Crybg3'
ID 550236
Institutional Source Beutler Lab
Gene Symbol Crybg3
Ensembl Gene ENSMUSG00000022723
Gene Name beta-gamma crystallin domain containing 3
Synonyms Gm9581
MMRRC Submission 045185-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.143) question?
Stock # R7091 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 59312451-59421410 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 59377531 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 1241 (D1241V)
Ref Sequence ENSEMBL: ENSMUSP00000156047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044604] [ENSMUST00000172910]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000044604
SMART Domains Protein: ENSMUSP00000037682
Gene: ENSMUSG00000022723

DomainStartEndE-ValueType
low complexity region 258 273 N/A INTRINSIC
low complexity region 282 290 N/A INTRINSIC
XTALbg 430 516 2.78e-4 SMART
Pfam:Crystall 536 599 3.3e-7 PFAM
XTALbg 614 699 1.2e-21 SMART
XTALbg 707 790 5.73e-19 SMART
XTALbg 803 881 6.87e-5 SMART
XTALbg 889 969 1.28e-7 SMART
RICIN 972 1104 8.16e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000172910
AA Change: D1241V

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd18 A C 3: 40,871,173 (GRCm39) I111L probably damaging Het
Ank1 A G 8: 23,548,679 (GRCm39) D11G probably benign Het
Ank2 G T 3: 126,817,000 (GRCm39) Q472K probably damaging Het
Apbb2 A T 5: 66,470,677 (GRCm39) L520H probably damaging Het
Baat T C 4: 49,499,692 (GRCm39) K205E probably benign Het
Brca1 T A 11: 101,417,253 (GRCm39) M294L probably benign Het
Capn1 A G 19: 6,041,586 (GRCm39) M641T possibly damaging Het
Cluap1 T A 16: 3,758,670 (GRCm39) D377E probably benign Het
Col6a2 C T 10: 76,450,925 (GRCm39) V39I unknown Het
Dnah10 A G 5: 124,893,206 (GRCm39) K3380R probably benign Het
Eml5 T C 12: 98,768,733 (GRCm39) I1400M probably benign Het
Fancd2 A G 6: 113,522,062 (GRCm39) D219G probably damaging Het
Fras1 A G 5: 96,856,535 (GRCm39) S1973G probably benign Het
Fsd1 G A 17: 56,300,876 (GRCm39) R245H probably damaging Het
G3bp1 T A 11: 55,387,047 (GRCm39) H271Q possibly damaging Het
Glce A G 9: 61,967,870 (GRCm39) V427A probably damaging Het
Gm5141 T C 13: 62,921,778 (GRCm39) T464A possibly damaging Het
Gulp1 T A 1: 44,805,294 (GRCm39) F128I probably damaging Het
H2-T13 T C 17: 36,394,833 (GRCm39) E30G possibly damaging Het
Hcrtr1 A C 4: 130,024,707 (GRCm39) L393W probably damaging Het
Heg1 T C 16: 33,547,090 (GRCm39) S650P probably benign Het
Hspa4l T A 3: 40,736,024 (GRCm39) N569K probably benign Het
Ifi206 A G 1: 173,301,441 (GRCm39) F746L unknown Het
Ivl T C 3: 92,479,549 (GRCm39) D172G possibly damaging Het
Lrp5 A T 19: 3,680,184 (GRCm39) D433E probably damaging Het
Mgam T C 6: 40,745,210 (GRCm39) S1826P possibly damaging Het
Ms4a18 A T 19: 10,986,092 (GRCm39) L206M probably damaging Het
Msln A T 17: 25,969,054 (GRCm39) C444S probably damaging Het
Mta1 A G 12: 113,100,022 (GRCm39) D644G probably damaging Het
Muc5ac G C 7: 141,363,424 (GRCm39) probably benign Het
Naa15 T C 3: 51,366,177 (GRCm39) probably null Het
Nadk A G 4: 155,672,215 (GRCm39) H302R probably benign Het
Neb T A 2: 52,146,124 (GRCm39) N15I Het
Nup153 A T 13: 46,837,404 (GRCm39) S1273T probably benign Het
Ofcc1 A G 13: 40,226,243 (GRCm39) I763T probably damaging Het
Or4b13 T C 2: 90,082,807 (GRCm39) Y175C probably damaging Het
Oxsr1 T C 9: 119,113,727 (GRCm39) I107V probably benign Het
Prmt5 A G 14: 54,748,799 (GRCm39) probably null Het
Ptk2 G A 15: 73,093,658 (GRCm39) P854S possibly damaging Het
Ranbp6 A G 19: 29,790,116 (GRCm39) S79P probably damaging Het
Reln T C 5: 22,104,027 (GRCm39) I3315V probably null Het
Rnf223 T C 4: 156,217,156 (GRCm39) V177A probably benign Het
Slc20a1 C T 2: 129,050,192 (GRCm39) T450M possibly damaging Het
Smg5 C T 3: 88,258,654 (GRCm39) P542S probably benign Het
Sorl1 T A 9: 41,913,930 (GRCm39) Q1333L probably benign Het
Spag5 T A 11: 78,204,017 (GRCm39) probably null Het
Spopfm1 T C 3: 94,173,945 (GRCm39) F314L probably damaging Het
Tdp2 T A 13: 25,022,207 (GRCm39) F209I probably damaging Het
Tgm4 C A 9: 122,869,525 (GRCm39) L35M probably damaging Het
Tma7 A G 9: 108,911,580 (GRCm39) probably benign Het
Tmprss4 A T 9: 45,095,571 (GRCm39) V91D probably damaging Het
Tnfsf4 T A 1: 161,223,268 (GRCm39) M39K probably benign Het
Ttn T A 2: 76,543,912 (GRCm39) T33025S probably benign Het
Tut1 A G 19: 8,943,175 (GRCm39) H754R probably benign Het
Vmn2r27 T G 6: 124,200,904 (GRCm39) Q351P possibly damaging Het
Wee2 G T 6: 40,438,936 (GRCm39) G353V probably benign Het
Zfp747l1 C A 7: 126,983,534 (GRCm39) A523S possibly damaging Het
Zfp879 T A 11: 50,724,222 (GRCm39) H278L probably damaging Het
Other mutations in Crybg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Crybg3 APN 16 59,350,803 (GRCm39) missense probably benign 0.15
IGL01305:Crybg3 APN 16 59,349,590 (GRCm39) missense probably damaging 1.00
IGL01809:Crybg3 APN 16 59,345,216 (GRCm39) critical splice donor site probably benign 0.00
IGL02247:Crybg3 APN 16 59,323,513 (GRCm39) missense probably damaging 1.00
IGL02252:Crybg3 APN 16 59,372,887 (GRCm39) splice site probably benign
IGL03036:Crybg3 APN 16 59,375,542 (GRCm39) missense possibly damaging 0.68
IGL03202:Crybg3 APN 16 59,315,072 (GRCm39) missense probably damaging 1.00
IGL03232:Crybg3 APN 16 59,350,731 (GRCm39) missense probably damaging 1.00
ANU22:Crybg3 UTSW 16 59,349,590 (GRCm39) missense probably damaging 1.00
R0052:Crybg3 UTSW 16 59,386,019 (GRCm39) splice site probably benign
R0335:Crybg3 UTSW 16 59,364,503 (GRCm39) missense probably damaging 1.00
R0691:Crybg3 UTSW 16 59,385,574 (GRCm39) critical splice donor site probably null
R1511:Crybg3 UTSW 16 59,374,475 (GRCm39) missense probably benign 0.01
R1579:Crybg3 UTSW 16 59,350,561 (GRCm39) missense probably damaging 1.00
R1965:Crybg3 UTSW 16 59,323,600 (GRCm39) missense probably damaging 1.00
R1982:Crybg3 UTSW 16 59,364,488 (GRCm39) missense possibly damaging 0.85
R2225:Crybg3 UTSW 16 59,375,041 (GRCm39) missense probably damaging 1.00
R4074:Crybg3 UTSW 16 59,376,120 (GRCm39) unclassified probably benign
R4210:Crybg3 UTSW 16 59,364,414 (GRCm39) missense probably damaging 1.00
R4393:Crybg3 UTSW 16 59,380,458 (GRCm39) unclassified probably benign
R4394:Crybg3 UTSW 16 59,380,458 (GRCm39) unclassified probably benign
R4397:Crybg3 UTSW 16 59,380,458 (GRCm39) unclassified probably benign
R4427:Crybg3 UTSW 16 59,363,562 (GRCm39) missense probably damaging 1.00
R4578:Crybg3 UTSW 16 59,350,564 (GRCm39) missense probably damaging 1.00
R4720:Crybg3 UTSW 16 59,360,180 (GRCm39) missense probably damaging 1.00
R4917:Crybg3 UTSW 16 59,350,782 (GRCm39) missense probably benign 0.14
R5007:Crybg3 UTSW 16 59,378,463 (GRCm39) unclassified probably benign
R5020:Crybg3 UTSW 16 59,375,159 (GRCm39) missense possibly damaging 0.55
R5155:Crybg3 UTSW 16 59,345,264 (GRCm39) missense possibly damaging 0.91
R5306:Crybg3 UTSW 16 59,380,356 (GRCm39) unclassified probably benign
R5342:Crybg3 UTSW 16 59,342,512 (GRCm39) missense probably damaging 1.00
R5687:Crybg3 UTSW 16 59,379,529 (GRCm39) missense probably benign 0.00
R5763:Crybg3 UTSW 16 59,374,973 (GRCm39) missense possibly damaging 0.74
R5860:Crybg3 UTSW 16 59,385,632 (GRCm39) missense probably damaging 1.00
R5950:Crybg3 UTSW 16 59,313,934 (GRCm39) unclassified probably benign
R6007:Crybg3 UTSW 16 59,374,837 (GRCm39) nonsense probably null
R6042:Crybg3 UTSW 16 59,370,838 (GRCm39) missense possibly damaging 0.70
R6049:Crybg3 UTSW 16 59,364,417 (GRCm39) missense probably benign 0.00
R6242:Crybg3 UTSW 16 59,376,053 (GRCm39) missense probably benign
R6301:Crybg3 UTSW 16 59,350,701 (GRCm39) missense probably damaging 1.00
R6408:Crybg3 UTSW 16 59,316,053 (GRCm39) missense possibly damaging 0.71
R6724:Crybg3 UTSW 16 59,364,501 (GRCm39) missense probably benign 0.13
R6745:Crybg3 UTSW 16 59,372,607 (GRCm39) missense possibly damaging 0.93
R6777:Crybg3 UTSW 16 59,378,678 (GRCm39) unclassified probably benign
R6843:Crybg3 UTSW 16 59,380,159 (GRCm39) missense probably benign 0.22
R6914:Crybg3 UTSW 16 59,360,183 (GRCm39) missense possibly damaging 0.89
R6942:Crybg3 UTSW 16 59,360,183 (GRCm39) missense possibly damaging 0.89
R7033:Crybg3 UTSW 16 59,374,528 (GRCm39) missense probably damaging 1.00
R7133:Crybg3 UTSW 16 59,357,167 (GRCm39) missense probably damaging 1.00
R7193:Crybg3 UTSW 16 59,379,956 (GRCm39) missense possibly damaging 0.87
R7204:Crybg3 UTSW 16 59,379,253 (GRCm39) missense probably benign 0.00
R7398:Crybg3 UTSW 16 59,377,688 (GRCm39) missense probably benign 0.38
R7666:Crybg3 UTSW 16 59,379,700 (GRCm39) nonsense probably null
R7691:Crybg3 UTSW 16 59,376,497 (GRCm39) missense not run
R7714:Crybg3 UTSW 16 59,379,236 (GRCm39) missense probably benign 0.19
R7860:Crybg3 UTSW 16 59,375,605 (GRCm39) missense probably benign 0.04
R7901:Crybg3 UTSW 16 59,377,907 (GRCm39) missense probably damaging 0.98
R8371:Crybg3 UTSW 16 59,377,414 (GRCm39) missense probably benign 0.00
R8394:Crybg3 UTSW 16 59,378,651 (GRCm39) missense probably benign 0.06
R8438:Crybg3 UTSW 16 59,385,655 (GRCm39) missense probably benign 0.02
R8529:Crybg3 UTSW 16 59,376,984 (GRCm39) missense probably damaging 0.98
R8699:Crybg3 UTSW 16 59,375,291 (GRCm39) missense probably damaging 1.00
R8766:Crybg3 UTSW 16 59,375,696 (GRCm39) missense probably benign 0.05
R8767:Crybg3 UTSW 16 59,376,500 (GRCm39) missense probably benign
R8789:Crybg3 UTSW 16 59,375,359 (GRCm39) missense probably benign 0.00
R8871:Crybg3 UTSW 16 59,378,519 (GRCm39) missense probably benign
R8878:Crybg3 UTSW 16 59,380,547 (GRCm39) missense probably benign 0.09
R8894:Crybg3 UTSW 16 59,342,552 (GRCm39) missense probably damaging 0.97
R8928:Crybg3 UTSW 16 59,376,715 (GRCm39) missense probably benign 0.40
R8928:Crybg3 UTSW 16 59,315,123 (GRCm39) missense probably benign 0.31
R8939:Crybg3 UTSW 16 59,376,512 (GRCm39) missense probably benign 0.00
R9010:Crybg3 UTSW 16 59,374,702 (GRCm39) missense probably damaging 0.98
R9266:Crybg3 UTSW 16 59,372,544 (GRCm39) missense probably damaging 0.99
R9348:Crybg3 UTSW 16 59,421,256 (GRCm39) start codon destroyed probably null 0.66
R9353:Crybg3 UTSW 16 59,421,107 (GRCm39) critical splice donor site probably null
R9406:Crybg3 UTSW 16 59,378,839 (GRCm39) missense probably benign 0.42
R9429:Crybg3 UTSW 16 59,375,556 (GRCm39) missense probably benign 0.08
R9464:Crybg3 UTSW 16 59,376,120 (GRCm39) unclassified probably benign
R9621:Crybg3 UTSW 16 59,326,613 (GRCm39) missense possibly damaging 0.73
R9703:Crybg3 UTSW 16 59,375,939 (GRCm39) missense probably damaging 0.96
R9751:Crybg3 UTSW 16 59,377,887 (GRCm39) missense possibly damaging 0.55
R9766:Crybg3 UTSW 16 59,376,207 (GRCm39) missense probably benign 0.03
RF007:Crybg3 UTSW 16 59,377,067 (GRCm39) missense possibly damaging 0.94
Z1177:Crybg3 UTSW 16 59,376,841 (GRCm39) missense probably benign 0.09
Z1177:Crybg3 UTSW 16 59,375,756 (GRCm39) nonsense probably null
Z1187:Crybg3 UTSW 16 59,326,608 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCCGGGTATCTTCAATCTCG -3'
(R):5'- CCCAAAAGAGCTGATACATTGACTG -3'

Sequencing Primer
(F):5'- CCGGGTATCTTCAATCTCGTCAAAAG -3'
(R):5'- ACTGAGGAGATTTTAAGTTCTGTCAG -3'
Posted On 2019-05-15