Incidental Mutation 'R7091:Msln'
ID 550237
Institutional Source Beutler Lab
Gene Symbol Msln
Ensembl Gene ENSMUSG00000063011
Gene Name mesothelin
Synonyms megakaryocyte potentiating factor, MPF
MMRRC Submission 045185-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.061) question?
Stock # R7091 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 25967587-25973352 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 25969054 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 444 (C444S)
Ref Sequence ENSEMBL: ENSMUSP00000075279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047098] [ENSMUST00000075884]
AlphaFold Q61468
Predicted Effect probably benign
Transcript: ENSMUST00000047098
SMART Domains Protein: ENSMUSP00000049020
Gene: ENSMUSG00000041062

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Mesothelin 29 589 2.8e-70 PFAM
low complexity region 633 653 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000075884
AA Change: C444S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075279
Gene: ENSMUSG00000063011
AA Change: C444S

DomainStartEndE-ValueType
Pfam:Mesothelin 1 624 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a preproprotein that is proteolytically processed to generate two protein products, megakaryocyte potentiating factor and mesothelin. Megakaryocyte potentiating factor functions as a cytokine that can stimulate colony formation of bone marrow megakaryocytes. Mesothelin is a glycosylphosphatidylinositol-anchored cell-surface protein that may function as a cell adhesion protein. This protein is overexpressed in epithelial mesotheliomas, ovarian cancers and in specific squamous cell carcinomas. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for disruptions in this allele display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd18 A C 3: 40,871,173 (GRCm39) I111L probably damaging Het
Ank1 A G 8: 23,548,679 (GRCm39) D11G probably benign Het
Ank2 G T 3: 126,817,000 (GRCm39) Q472K probably damaging Het
Apbb2 A T 5: 66,470,677 (GRCm39) L520H probably damaging Het
Baat T C 4: 49,499,692 (GRCm39) K205E probably benign Het
Brca1 T A 11: 101,417,253 (GRCm39) M294L probably benign Het
Capn1 A G 19: 6,041,586 (GRCm39) M641T possibly damaging Het
Cluap1 T A 16: 3,758,670 (GRCm39) D377E probably benign Het
Col6a2 C T 10: 76,450,925 (GRCm39) V39I unknown Het
Crybg3 T A 16: 59,377,531 (GRCm39) D1241V possibly damaging Het
Dnah10 A G 5: 124,893,206 (GRCm39) K3380R probably benign Het
Eml5 T C 12: 98,768,733 (GRCm39) I1400M probably benign Het
Fancd2 A G 6: 113,522,062 (GRCm39) D219G probably damaging Het
Fras1 A G 5: 96,856,535 (GRCm39) S1973G probably benign Het
Fsd1 G A 17: 56,300,876 (GRCm39) R245H probably damaging Het
G3bp1 T A 11: 55,387,047 (GRCm39) H271Q possibly damaging Het
Glce A G 9: 61,967,870 (GRCm39) V427A probably damaging Het
Gm5141 T C 13: 62,921,778 (GRCm39) T464A possibly damaging Het
Gulp1 T A 1: 44,805,294 (GRCm39) F128I probably damaging Het
H2-T13 T C 17: 36,394,833 (GRCm39) E30G possibly damaging Het
Hcrtr1 A C 4: 130,024,707 (GRCm39) L393W probably damaging Het
Heg1 T C 16: 33,547,090 (GRCm39) S650P probably benign Het
Hspa4l T A 3: 40,736,024 (GRCm39) N569K probably benign Het
Ifi206 A G 1: 173,301,441 (GRCm39) F746L unknown Het
Ivl T C 3: 92,479,549 (GRCm39) D172G possibly damaging Het
Lrp5 A T 19: 3,680,184 (GRCm39) D433E probably damaging Het
Mgam T C 6: 40,745,210 (GRCm39) S1826P possibly damaging Het
Ms4a18 A T 19: 10,986,092 (GRCm39) L206M probably damaging Het
Mta1 A G 12: 113,100,022 (GRCm39) D644G probably damaging Het
Muc5ac G C 7: 141,363,424 (GRCm39) probably benign Het
Naa15 T C 3: 51,366,177 (GRCm39) probably null Het
Nadk A G 4: 155,672,215 (GRCm39) H302R probably benign Het
Neb T A 2: 52,146,124 (GRCm39) N15I Het
Nup153 A T 13: 46,837,404 (GRCm39) S1273T probably benign Het
Ofcc1 A G 13: 40,226,243 (GRCm39) I763T probably damaging Het
Or4b13 T C 2: 90,082,807 (GRCm39) Y175C probably damaging Het
Oxsr1 T C 9: 119,113,727 (GRCm39) I107V probably benign Het
Prmt5 A G 14: 54,748,799 (GRCm39) probably null Het
Ptk2 G A 15: 73,093,658 (GRCm39) P854S possibly damaging Het
Ranbp6 A G 19: 29,790,116 (GRCm39) S79P probably damaging Het
Reln T C 5: 22,104,027 (GRCm39) I3315V probably null Het
Rnf223 T C 4: 156,217,156 (GRCm39) V177A probably benign Het
Slc20a1 C T 2: 129,050,192 (GRCm39) T450M possibly damaging Het
Smg5 C T 3: 88,258,654 (GRCm39) P542S probably benign Het
Sorl1 T A 9: 41,913,930 (GRCm39) Q1333L probably benign Het
Spag5 T A 11: 78,204,017 (GRCm39) probably null Het
Spopfm1 T C 3: 94,173,945 (GRCm39) F314L probably damaging Het
Tdp2 T A 13: 25,022,207 (GRCm39) F209I probably damaging Het
Tgm4 C A 9: 122,869,525 (GRCm39) L35M probably damaging Het
Tma7 A G 9: 108,911,580 (GRCm39) probably benign Het
Tmprss4 A T 9: 45,095,571 (GRCm39) V91D probably damaging Het
Tnfsf4 T A 1: 161,223,268 (GRCm39) M39K probably benign Het
Ttn T A 2: 76,543,912 (GRCm39) T33025S probably benign Het
Tut1 A G 19: 8,943,175 (GRCm39) H754R probably benign Het
Vmn2r27 T G 6: 124,200,904 (GRCm39) Q351P possibly damaging Het
Wee2 G T 6: 40,438,936 (GRCm39) G353V probably benign Het
Zfp747l1 C A 7: 126,983,534 (GRCm39) A523S possibly damaging Het
Zfp879 T A 11: 50,724,222 (GRCm39) H278L probably damaging Het
Other mutations in Msln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01739:Msln APN 17 25,969,004 (GRCm39) critical splice donor site probably null
IGL02986:Msln APN 17 25,971,907 (GRCm39) splice site probably benign
R0349:Msln UTSW 17 25,969,250 (GRCm39) missense possibly damaging 0.69
R0562:Msln UTSW 17 25,971,980 (GRCm39) missense probably benign 0.16
R0845:Msln UTSW 17 25,969,770 (GRCm39) missense probably damaging 1.00
R1256:Msln UTSW 17 25,973,157 (GRCm39) missense probably damaging 1.00
R1305:Msln UTSW 17 25,972,001 (GRCm39) missense probably benign 0.00
R1651:Msln UTSW 17 25,972,382 (GRCm39) missense probably benign 0.00
R1930:Msln UTSW 17 25,970,896 (GRCm39) missense probably damaging 0.99
R1996:Msln UTSW 17 25,973,193 (GRCm39) start codon destroyed possibly damaging 0.94
R4532:Msln UTSW 17 25,969,698 (GRCm39) missense probably damaging 0.98
R5004:Msln UTSW 17 25,973,193 (GRCm39) start codon destroyed possibly damaging 0.94
R5157:Msln UTSW 17 25,971,957 (GRCm39) missense probably benign 0.01
R5159:Msln UTSW 17 25,970,563 (GRCm39) missense probably benign 0.01
R5510:Msln UTSW 17 25,968,847 (GRCm39) missense probably benign 0.15
R6385:Msln UTSW 17 25,970,115 (GRCm39) missense probably benign 0.19
R6650:Msln UTSW 17 25,969,144 (GRCm39) missense probably benign 0.00
R6682:Msln UTSW 17 25,971,993 (GRCm39) missense probably damaging 0.99
R7472:Msln UTSW 17 25,969,708 (GRCm39) missense possibly damaging 0.95
R8085:Msln UTSW 17 25,971,942 (GRCm39) nonsense probably null
R8289:Msln UTSW 17 25,967,880 (GRCm39) missense possibly damaging 0.50
R9137:Msln UTSW 17 25,969,084 (GRCm39) missense probably benign 0.24
R9217:Msln UTSW 17 25,970,125 (GRCm39) missense probably benign 0.02
R9309:Msln UTSW 17 25,970,148 (GRCm39) missense possibly damaging 0.68
R9311:Msln UTSW 17 25,971,990 (GRCm39) missense probably benign 0.09
R9441:Msln UTSW 17 25,969,731 (GRCm39) missense probably benign 0.02
R9652:Msln UTSW 17 25,968,042 (GRCm39) missense probably damaging 1.00
R9723:Msln UTSW 17 25,969,008 (GRCm39) missense possibly damaging 0.55
R9798:Msln UTSW 17 25,972,771 (GRCm39) missense probably benign 0.01
X0002:Msln UTSW 17 25,971,284 (GRCm39) splice site probably null
Z1176:Msln UTSW 17 25,972,768 (GRCm39) missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- TCTGGTAGAGGAGACCCAGATG -3'
(R):5'- TGCTCAAAGTCAGCAAAGGAC -3'

Sequencing Primer
(F):5'- GCCTCTGGCTGCACTTG -3'
(R):5'- GATGAATGCTCAGGTAACATCTAC -3'
Posted On 2019-05-15