Mutagenetix > Incidental Mutation

Incidental Mutation 'R7091:Lrp5'

550240

Institutional Source

Beutler Lab

Gene Symbol

Lrp5

Ensembl Gene

ENSMUSG00000024913

Gene Name

low density lipoprotein receptor-related protein 5

Synonyms

LR3, LRP7

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.926) question?

Stock #

R7091 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

3584828-3686564 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 3630184 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 433 (D433E)

Ref Sequence

ENSEMBL: ENSMUSP00000025856 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025856] [ENSMUST00000176867] [ENSMUST00000177330]

AlphaFold

Q91VN0

Predicted Effect

probably damaging
Transcript: ENSMUST00000025856
AA Change: D433E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000025856
Gene: ENSMUSG00000024913
AA Change: D433E

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
LY	54	96	1.26e0	SMART
LY	99	141	2.11e-13	SMART
LY	142	185	1.32e-14	SMART
LY	186	228	1.6e-13	SMART
LY	229	270	4e-5	SMART
EGF	297	336	1.01e-1	SMART
LY	364	406	5.15e-8	SMART
LY	407	449	4.12e-16	SMART
LY	450	493	7.68e-16	SMART
LY	494	536	6.24e-16	SMART
LY	537	577	3.73e-5	SMART
EGF	603	640	2.48e-1	SMART
LY	666	708	5.92e-8	SMART
LY	709	751	5.65e-14	SMART
LY	752	795	3.81e-11	SMART
LY	796	837	3.54e-6	SMART
LY	838	877	1.33e-1	SMART
EGF	904	941	1.22e0	SMART
LY	968	1009	4.39e-2	SMART
LY	1015	1057	1.81e0	SMART
LY	1058	1102	9.47e-7	SMART
LY	1103	1145	6.91e-9	SMART
LY	1146	1186	1.53e0	SMART
EGF	1215	1253	2.85e-1	SMART
LDLa	1257	1296	1.23e-13	SMART
LDLa	1297	1333	3.26e-9	SMART
LDLa	1334	1371	1.31e-13	SMART
transmembrane domain	1384	1406	N/A	INTRINSIC
low complexity region	1494	1503	N/A	INTRINSIC
low complexity region	1571	1578	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000176867
AA Change: D433E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000135654
Gene: ENSMUSG00000024913
AA Change: D433E

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
LY	54	96	1.26e0	SMART
LY	99	141	2.11e-13	SMART
LY	142	185	1.32e-14	SMART
LY	186	228	1.6e-13	SMART
LY	229	270	4e-5	SMART
EGF	297	336	1.01e-1	SMART
LY	364	406	5.15e-8	SMART
LY	407	449	4.12e-16	SMART
LY	450	493	7.68e-16	SMART
LY	494	536	6.24e-16	SMART
LY	537	577	3.73e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000177330

SMART Domains

Protein: ENSMUSP00000134983
Gene: ENSMUSG00000024913

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
LY	54	96	1.26e0	SMART
LY	99	141	2.11e-13	SMART
LY	142	185	1.32e-14	SMART
LY	186	228	1.6e-13	SMART

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

98% (56/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane low-density lipoprotein receptor that binds and internalizes ligands in the process of receptor-mediated endocytosis. This protein also acts as a co-receptor with Frizzled protein family members for transducing signals by Wnt proteins and was originally cloned on the basis of its association with type 1 diabetes mellitus in humans. This protein plays a key role in skeletal homeostasis and many bone density related diseases are caused by mutations in this gene. Mutations in this gene also cause familial exudative vitreoretinopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous mutants show variable bone loss, decreased osteoblast proliferation, impaired glucose tolerance, increased plasma cholesterol on high-fat diet and persistent embryonic eye vascularization, depending on allelic combination and strain background. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130019O22Rik	C	A	7: 127,384,362	A523S	possibly damaging	Het
Abhd18	A	C	3: 40,916,738	I111L	probably damaging	Het
Ank1	A	G	8: 23,058,663	D11G	probably benign	Het
Ank2	G	T	3: 127,023,351	Q472K	probably damaging	Het
Apbb2	A	T	5: 66,313,334	L520H	probably damaging	Het
Baat	T	C	4: 49,499,692	K205E	probably benign	Het
Brca1	T	A	11: 101,526,427	M294L	probably benign	Het
Capn1	A	G	19: 5,991,556	M641T	possibly damaging	Het
Cluap1	T	A	16: 3,940,806	D377E	probably benign	Het
Col6a2	C	T	10: 76,615,091	V39I	unknown	Het
Crybg3	T	A	16: 59,557,168	D1241V	possibly damaging	Het
Dnah10	A	G	5: 124,816,142	K3380R	probably benign	Het
Eml5	T	C	12: 98,802,474	I1400M	probably benign	Het
Fancd2	A	G	6: 113,545,101	D219G	probably damaging	Het
Fras1	A	G	5: 96,708,676	S1973G	probably benign	Het
Fsd1	G	A	17: 55,993,876	R245H	probably damaging	Het
G3bp1	T	A	11: 55,496,221	H271Q	possibly damaging	Het
Glce	A	G	9: 62,060,588	V427A	probably damaging	Het
Gm4778	T	C	3: 94,266,638	F314L	probably damaging	Het
Gm5141	T	C	13: 62,773,964	T464A	possibly damaging	Het
Gulp1	T	A	1: 44,766,134	F128I	probably damaging	Het
H2-Bl	T	C	17: 36,083,941	E30G	possibly damaging	Het
Hcrtr1	A	C	4: 130,130,914	L393W	probably damaging	Het
Heg1	T	C	16: 33,726,720	S650P	probably benign	Het
Hspa4l	T	A	3: 40,781,592	N569K	probably benign	Het
Ifi206	A	G	1: 173,473,875	F746L	unknown	Het
Ivl	T	C	3: 92,572,242	D172G	possibly damaging	Het
Mgam	T	C	6: 40,768,276	S1826P	possibly damaging	Het
Ms4a18	A	T	19: 11,008,728	L206M	probably damaging	Het
Msln	A	T	17: 25,750,080	C444S	probably damaging	Het
Mta1	A	G	12: 113,136,402	D644G	probably damaging	Het
Muc5ac	G	C	7: 141,809,687		probably benign	Het
Naa15	T	C	3: 51,458,756		probably null	Het
Nadk	A	G	4: 155,587,758	H302R	probably benign	Het
Neb	T	A	2: 52,256,112	N15I		Het
Nup153	A	T	13: 46,683,928	S1273T	probably benign	Het
Ofcc1	A	G	13: 40,072,767	I763T	probably damaging	Het
Olfr142	T	C	2: 90,252,463	Y175C	probably damaging	Het
Oxsr1	T	C	9: 119,284,661	I107V	probably benign	Het
Prmt5	A	G	14: 54,511,342		probably null	Het
Ptk2	G	A	15: 73,221,809	P854S	possibly damaging	Het
Ranbp6	A	G	19: 29,812,716	S79P	probably damaging	Het
Reln	T	C	5: 21,899,029	I3315V	probably null	Het
Rnf223	T	C	4: 156,132,699	V177A	probably benign	Het
Slc20a1	C	T	2: 129,208,272	T450M	possibly damaging	Het
Smg5	C	T	3: 88,351,347	P542S	probably benign	Het
Sorl1	T	A	9: 42,002,634	Q1333L	probably benign	Het
Spag5	T	A	11: 78,313,191		probably null	Het
Tdp2	T	A	13: 24,838,224	F209I	probably damaging	Het
Tgm4	C	A	9: 123,040,460	L35M	probably damaging	Het
Tma7	A	G	9: 109,082,512		probably benign	Het
Tmprss4	A	T	9: 45,184,273	V91D	probably damaging	Het
Tnfsf4	T	A	1: 161,395,697	M39K	probably benign	Het
Ttn	T	A	2: 76,713,568	T33025S	probably benign	Het
Tut1	A	G	19: 8,965,811	H754R	probably benign	Het
Vmn2r27	T	G	6: 124,223,945	Q351P	possibly damaging	Het
Wee2	G	T	6: 40,462,002	G353V	probably benign	Het
Zfp879	T	A	11: 50,833,395	H278L	probably damaging	Het

Other mutations in Lrp5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00834:Lrp5	APN	19	3649404	missense	probably benign
IGL00902:Lrp5	APN	19	3600774	missense	probably damaging	1.00
IGL02032:Lrp5	APN	19	3615886	splice site	probably benign
IGL02331:Lrp5	APN	19	3591816	missense	possibly damaging	0.64
IGL02401:Lrp5	APN	19	3593585	missense	probably damaging	1.00
IGL02471:Lrp5	APN	19	3602408	missense	probably benign	0.31
IGL02572:Lrp5	APN	19	3614283	missense	probably benign	0.17
IGL02637:Lrp5	APN	19	3630269	missense	probably benign	0.03
IGL02696:Lrp5	APN	19	3602253	missense	probably benign
IGL02742:Lrp5	APN	19	3604022	missense	probably damaging	0.99
IGL02804:Lrp5	APN	19	3600777	missense	possibly damaging	0.63
IGL03089:Lrp5	APN	19	3620314	splice site	probably null
IGL03243:Lrp5	APN	19	3630159	missense	probably benign	0.12
Contrarian	UTSW	19	3659355	missense	probably damaging	1.00
Contrarian2	UTSW	19	3652296	missense	probably damaging	1.00
lucent	UTSW	19	3686353	critical splice donor site	probably null
Microtome	UTSW	19	3622638	missense	probably damaging	1.00
r18	UTSW	19		small insertion
Spicule	UTSW	19	3612197	critical splice donor site	probably null
Stirrup	UTSW	19	3600753	missense	probably damaging	1.00
PIT4494001:Lrp5	UTSW	19	3610091	missense	probably damaging	1.00
R0219:Lrp5	UTSW	19	3597349	missense	probably damaging	1.00
R0526:Lrp5	UTSW	19	3628295	missense	probably damaging	1.00
R0597:Lrp5	UTSW	19	3600777	missense	possibly damaging	0.63
R0883:Lrp5	UTSW	19	3605308	missense	probably damaging	1.00
R1086:Lrp5	UTSW	19	3649476	missense	probably benign	0.28
R1417:Lrp5	UTSW	19	3586425	missense	probably benign	0.04
R1468:Lrp5	UTSW	19	3620191	missense	possibly damaging	0.76
R1468:Lrp5	UTSW	19	3620191	missense	possibly damaging	0.76
R1533:Lrp5	UTSW	19	3614234	missense	probably benign	0.17
R1538:Lrp5	UTSW	19	3647585	missense	possibly damaging	0.70
R1856:Lrp5	UTSW	19	3597346	missense	probably benign	0.18
R1930:Lrp5	UTSW	19	3610131	missense	probably benign	0.02
R1931:Lrp5	UTSW	19	3610131	missense	probably benign	0.02
R1932:Lrp5	UTSW	19	3610131	missense	probably benign	0.02
R1951:Lrp5	UTSW	19	3620298	missense	possibly damaging	0.89
R2016:Lrp5	UTSW	19	3610056	missense	probably benign	0.04
R2131:Lrp5	UTSW	19	3622708	missense	possibly damaging	0.87
R2153:Lrp5	UTSW	19	3614339	missense	probably benign	0.22
R2403:Lrp5	UTSW	19	3597430	missense	probably damaging	1.00
R3158:Lrp5	UTSW	19	3615849	missense	probably damaging	0.97
R3771:Lrp5	UTSW	19	3612330	missense	probably damaging	1.00
R3772:Lrp5	UTSW	19	3612330	missense	probably damaging	1.00
R3773:Lrp5	UTSW	19	3612330	missense	probably damaging	1.00
R3825:Lrp5	UTSW	19	3605290	nonsense	probably null
R3887:Lrp5	UTSW	19	3612330	missense	probably damaging	1.00
R3888:Lrp5	UTSW	19	3612330	missense	probably damaging	1.00
R3893:Lrp5	UTSW	19	3612330	missense	probably damaging	1.00
R3917:Lrp5	UTSW	19	3612330	missense	probably damaging	1.00
R4279:Lrp5	UTSW	19	3591778	missense	possibly damaging	0.94
R4714:Lrp5	UTSW	19	3659454	missense	probably damaging	1.00
R4825:Lrp5	UTSW	19	3614292	missense	probably damaging	1.00
R5102:Lrp5	UTSW	19	3659304	missense	probably damaging	0.96
R5138:Lrp5	UTSW	19	3628319	missense	probably benign	0.03
R5497:Lrp5	UTSW	19	3602319	missense	probably damaging	1.00
R5632:Lrp5	UTSW	19	3622512	missense	probably benign
R5887:Lrp5	UTSW	19	3604094	missense	probably benign	0.01
R5950:Lrp5	UTSW	19	3602333	missense	probably benign	0.17
R5987:Lrp5	UTSW	19	3628299	missense	probably damaging	1.00
R6080:Lrp5	UTSW	19	3628316	missense	probably benign	0.32
R6181:Lrp5	UTSW	19	3628427	missense	probably damaging	1.00
R6236:Lrp5	UTSW	19	3630483	splice site	probably null
R6332:Lrp5	UTSW	19	3659355	missense	probably damaging	1.00
R6511:Lrp5	UTSW	19	3652296	missense	probably damaging	1.00
R6641:Lrp5	UTSW	19	3652287	missense	probably damaging	1.00
R6791:Lrp5	UTSW	19	3600753	missense	probably damaging	1.00
R6865:Lrp5	UTSW	19	3620013	critical splice donor site	probably null
R6906:Lrp5	UTSW	19	3622638	missense	probably damaging	1.00
R6922:Lrp5	UTSW	19	3605301	missense	probably damaging	1.00
R7303:Lrp5	UTSW	19	3591774	missense	probably damaging	0.99
R7368:Lrp5	UTSW	19	3620085	missense	possibly damaging	0.95
R7381:Lrp5	UTSW	19	3593588	missense	probably benign	0.20
R7385:Lrp5	UTSW	19	3612197	critical splice donor site	probably null
R7392:Lrp5	UTSW	19	3610199	missense	probably damaging	1.00
R7448:Lrp5	UTSW	19	3649439	missense	probably benign	0.01
R7585:Lrp5	UTSW	19	3604094	missense	possibly damaging	0.88
R7662:Lrp5	UTSW	19	3686353	critical splice donor site	probably null
R7984:Lrp5	UTSW	19	3612342	missense	probably damaging	1.00
R8056:Lrp5	UTSW	19	3597337	missense	probably damaging	0.98
R8391:Lrp5	UTSW	19	3604185	missense	probably damaging	1.00
R8881:Lrp5	UTSW	19	3591015	missense	probably damaging	0.98
R8885:Lrp5	UTSW	19	3652170	missense	probably damaging	1.00
R9051:Lrp5	UTSW	19	3630156	missense	possibly damaging	0.89
R9263:Lrp5	UTSW	19	3604190	missense	probably damaging	1.00
R9376:Lrp5	UTSW	19	3620286	missense	probably benign	0.00
R9400:Lrp5	UTSW	19	3585272	missense	probably benign	0.00
R9536:Lrp5	UTSW	19	3622672	missense	probably damaging	1.00
R9600:Lrp5	UTSW	19	3591712	missense	probably benign	0.00
Z1177:Lrp5	UTSW	19	3628345	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CTGCAAGCCCTTTGAGAAATGC -3'
(R):5'- ATGCCATTGCCATTGACTACG -3'

Sequencing Primer
(F):5'- AGTCCTGACTCTGCATATCTCAGAG -3'
(R):5'- ATTGACTACGATCCCCTGGAG -3'

Posted On

2019-05-15