Incidental Mutation 'R7091:Capn1'
ID 550241
Institutional Source Beutler Lab
Gene Symbol Capn1
Ensembl Gene ENSMUSG00000024942
Gene Name calpain 1
Synonyms mu-calpin, Capa1, Capa-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7091 (G1)
Quality Score 191.009
Status Validated
Chromosome 19
Chromosomal Location 5988546-6015825 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 5991556 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 641 (M641T)
Ref Sequence ENSEMBL: ENSMUSP00000025891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025891] [ENSMUST00000164843]
AlphaFold O35350
Predicted Effect possibly damaging
Transcript: ENSMUST00000025891
AA Change: M641T

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000025891
Gene: ENSMUSG00000024942
AA Change: M641T

DomainStartEndE-ValueType
CysPc 37 362 6.79e-180 SMART
calpain_III 365 521 7.38e-94 SMART
EFh 588 616 1.13e1 SMART
EFh 618 646 2.95e0 SMART
EFh 683 711 7.65e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000164843
AA Change: M641T

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000127498
Gene: ENSMUSG00000024942
AA Change: M641T

DomainStartEndE-ValueType
CysPc 37 362 6.79e-180 SMART
calpain_III 365 521 7.38e-94 SMART
EFh 588 616 1.13e1 SMART
EFh 618 646 2.95e0 SMART
EFh 683 711 7.65e1 SMART
Meta Mutation Damage Score 0.1331 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The calpains, calcium-activated neutral proteases, are nonlysosomal, intracellular cysteine proteases. The mammalian calpains include ubiquitous, stomach-specific, and muscle-specific proteins. The ubiquitous enzymes consist of heterodimers with distinct large, catalytic subunits associated with a common small, regulatory subunit. This gene encodes the large subunit of the ubiquitous enzyme, calpain 1. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Animals homozygous for a mutation of this gene exhibit decreased platelet aggregation and defective clot retraction although bleeding times remain similar to wild-type. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik C A 7: 127,384,362 A523S possibly damaging Het
Abhd18 A C 3: 40,916,738 I111L probably damaging Het
Ank1 A G 8: 23,058,663 D11G probably benign Het
Ank2 G T 3: 127,023,351 Q472K probably damaging Het
Apbb2 A T 5: 66,313,334 L520H probably damaging Het
Baat T C 4: 49,499,692 K205E probably benign Het
Brca1 T A 11: 101,526,427 M294L probably benign Het
Cluap1 T A 16: 3,940,806 D377E probably benign Het
Col6a2 C T 10: 76,615,091 V39I unknown Het
Crybg3 T A 16: 59,557,168 D1241V possibly damaging Het
Dnah10 A G 5: 124,816,142 K3380R probably benign Het
Eml5 T C 12: 98,802,474 I1400M probably benign Het
Fancd2 A G 6: 113,545,101 D219G probably damaging Het
Fras1 A G 5: 96,708,676 S1973G probably benign Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
G3bp1 T A 11: 55,496,221 H271Q possibly damaging Het
Glce A G 9: 62,060,588 V427A probably damaging Het
Gm4778 T C 3: 94,266,638 F314L probably damaging Het
Gm5141 T C 13: 62,773,964 T464A possibly damaging Het
Gulp1 T A 1: 44,766,134 F128I probably damaging Het
H2-Bl T C 17: 36,083,941 E30G possibly damaging Het
Hcrtr1 A C 4: 130,130,914 L393W probably damaging Het
Heg1 T C 16: 33,726,720 S650P probably benign Het
Hspa4l T A 3: 40,781,592 N569K probably benign Het
Ifi206 A G 1: 173,473,875 F746L unknown Het
Ivl T C 3: 92,572,242 D172G possibly damaging Het
Lrp5 A T 19: 3,630,184 D433E probably damaging Het
Mgam T C 6: 40,768,276 S1826P possibly damaging Het
Ms4a18 A T 19: 11,008,728 L206M probably damaging Het
Msln A T 17: 25,750,080 C444S probably damaging Het
Mta1 A G 12: 113,136,402 D644G probably damaging Het
Muc5ac G C 7: 141,809,687 probably benign Het
Naa15 T C 3: 51,458,756 probably null Het
Nadk A G 4: 155,587,758 H302R probably benign Het
Neb T A 2: 52,256,112 N15I Het
Nup153 A T 13: 46,683,928 S1273T probably benign Het
Ofcc1 A G 13: 40,072,767 I763T probably damaging Het
Olfr142 T C 2: 90,252,463 Y175C probably damaging Het
Oxsr1 T C 9: 119,284,661 I107V probably benign Het
Prmt5 A G 14: 54,511,342 probably null Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Ranbp6 A G 19: 29,812,716 S79P probably damaging Het
Reln T C 5: 21,899,029 I3315V probably null Het
Rnf223 T C 4: 156,132,699 V177A probably benign Het
Slc20a1 C T 2: 129,208,272 T450M possibly damaging Het
Smg5 C T 3: 88,351,347 P542S probably benign Het
Sorl1 T A 9: 42,002,634 Q1333L probably benign Het
Spag5 T A 11: 78,313,191 probably null Het
Tdp2 T A 13: 24,838,224 F209I probably damaging Het
Tgm4 C A 9: 123,040,460 L35M probably damaging Het
Tma7 A G 9: 109,082,512 probably benign Het
Tmprss4 A T 9: 45,184,273 V91D probably damaging Het
Tnfsf4 T A 1: 161,395,697 M39K probably benign Het
Ttn T A 2: 76,713,568 T33025S probably benign Het
Tut1 A G 19: 8,965,811 H754R probably benign Het
Vmn2r27 T G 6: 124,223,945 Q351P possibly damaging Het
Wee2 G T 6: 40,462,002 G353V probably benign Het
Zfp879 T A 11: 50,833,395 H278L probably damaging Het
Other mutations in Capn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Capn1 APN 19 6007269 missense probably damaging 1.00
IGL01314:Capn1 APN 19 5989984 splice site probably benign
R0044:Capn1 UTSW 19 6014343 missense probably benign 0.03
R1496:Capn1 UTSW 19 6007498 critical splice donor site probably null
R1646:Capn1 UTSW 19 5997730 missense probably benign
R1852:Capn1 UTSW 19 6009103 missense possibly damaging 0.95
R1924:Capn1 UTSW 19 5990056 splice site probably null
R2006:Capn1 UTSW 19 5991583 missense probably damaging 1.00
R2109:Capn1 UTSW 19 6014358 missense probably benign 0.01
R3704:Capn1 UTSW 19 6007371 missense probably damaging 1.00
R3705:Capn1 UTSW 19 6007371 missense probably damaging 1.00
R3830:Capn1 UTSW 19 5994847 missense probably damaging 1.00
R4664:Capn1 UTSW 19 6011015 missense probably benign 0.03
R4665:Capn1 UTSW 19 6011015 missense probably benign 0.03
R4666:Capn1 UTSW 19 6011015 missense probably benign 0.03
R4694:Capn1 UTSW 19 5994731 nonsense probably null
R4745:Capn1 UTSW 19 5993916 missense probably benign 0.12
R5103:Capn1 UTSW 19 6009110 missense probably damaging 1.00
R5149:Capn1 UTSW 19 5990334 splice site probably null
R5569:Capn1 UTSW 19 6013660 missense probably benign
R5636:Capn1 UTSW 19 6014442 missense probably benign 0.22
R5906:Capn1 UTSW 19 6011421 missense possibly damaging 0.90
R5907:Capn1 UTSW 19 5997797 missense probably benign
R7038:Capn1 UTSW 19 6014319 missense probably benign 0.23
R7307:Capn1 UTSW 19 5993908 missense possibly damaging 0.91
R7592:Capn1 UTSW 19 6014439 missense probably benign 0.00
R7779:Capn1 UTSW 19 5994086 missense probably benign
R8514:Capn1 UTSW 19 5997824 missense probably damaging 0.98
R8708:Capn1 UTSW 19 6011298 missense probably damaging 1.00
R9452:Capn1 UTSW 19 6007257 missense probably damaging 1.00
Z1176:Capn1 UTSW 19 6014278 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGAAAAGGCCCTTGTTCTTGG -3'
(R):5'- CAACAGAGCTTCCTTTCCGC -3'

Sequencing Primer
(F):5'- AAAAGGCCCTTGTTCTTGGTAAGC -3'
(R):5'- AGAGCTTCCTTTCCGCATGTG -3'
Posted On 2019-05-15