Incidental Mutation 'R7091:Capn1'
ID 550241
Institutional Source Beutler Lab
Gene Symbol Capn1
Ensembl Gene ENSMUSG00000024942
Gene Name calpain 1
Synonyms Capa1, Capa-1, mu-calpin
MMRRC Submission 045185-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7091 (G1)
Quality Score 191.009
Status Validated
Chromosome 19
Chromosomal Location 6038573-6065855 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 6041586 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 641 (M641T)
Ref Sequence ENSEMBL: ENSMUSP00000025891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025891] [ENSMUST00000164843]
AlphaFold O35350
Predicted Effect possibly damaging
Transcript: ENSMUST00000025891
AA Change: M641T

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000025891
Gene: ENSMUSG00000024942
AA Change: M641T

DomainStartEndE-ValueType
CysPc 37 362 6.79e-180 SMART
calpain_III 365 521 7.38e-94 SMART
EFh 588 616 1.13e1 SMART
EFh 618 646 2.95e0 SMART
EFh 683 711 7.65e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000164843
AA Change: M641T

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000127498
Gene: ENSMUSG00000024942
AA Change: M641T

DomainStartEndE-ValueType
CysPc 37 362 6.79e-180 SMART
calpain_III 365 521 7.38e-94 SMART
EFh 588 616 1.13e1 SMART
EFh 618 646 2.95e0 SMART
EFh 683 711 7.65e1 SMART
Meta Mutation Damage Score 0.1331 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The calpains, calcium-activated neutral proteases, are nonlysosomal, intracellular cysteine proteases. The mammalian calpains include ubiquitous, stomach-specific, and muscle-specific proteins. The ubiquitous enzymes consist of heterodimers with distinct large, catalytic subunits associated with a common small, regulatory subunit. This gene encodes the large subunit of the ubiquitous enzyme, calpain 1. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Animals homozygous for a mutation of this gene exhibit decreased platelet aggregation and defective clot retraction although bleeding times remain similar to wild-type. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd18 A C 3: 40,871,173 (GRCm39) I111L probably damaging Het
Ank1 A G 8: 23,548,679 (GRCm39) D11G probably benign Het
Ank2 G T 3: 126,817,000 (GRCm39) Q472K probably damaging Het
Apbb2 A T 5: 66,470,677 (GRCm39) L520H probably damaging Het
Baat T C 4: 49,499,692 (GRCm39) K205E probably benign Het
Brca1 T A 11: 101,417,253 (GRCm39) M294L probably benign Het
Cluap1 T A 16: 3,758,670 (GRCm39) D377E probably benign Het
Col6a2 C T 10: 76,450,925 (GRCm39) V39I unknown Het
Crybg3 T A 16: 59,377,531 (GRCm39) D1241V possibly damaging Het
Dnah10 A G 5: 124,893,206 (GRCm39) K3380R probably benign Het
Eml5 T C 12: 98,768,733 (GRCm39) I1400M probably benign Het
Fancd2 A G 6: 113,522,062 (GRCm39) D219G probably damaging Het
Fras1 A G 5: 96,856,535 (GRCm39) S1973G probably benign Het
Fsd1 G A 17: 56,300,876 (GRCm39) R245H probably damaging Het
G3bp1 T A 11: 55,387,047 (GRCm39) H271Q possibly damaging Het
Glce A G 9: 61,967,870 (GRCm39) V427A probably damaging Het
Gm5141 T C 13: 62,921,778 (GRCm39) T464A possibly damaging Het
Gulp1 T A 1: 44,805,294 (GRCm39) F128I probably damaging Het
H2-T13 T C 17: 36,394,833 (GRCm39) E30G possibly damaging Het
Hcrtr1 A C 4: 130,024,707 (GRCm39) L393W probably damaging Het
Heg1 T C 16: 33,547,090 (GRCm39) S650P probably benign Het
Hspa4l T A 3: 40,736,024 (GRCm39) N569K probably benign Het
Ifi206 A G 1: 173,301,441 (GRCm39) F746L unknown Het
Ivl T C 3: 92,479,549 (GRCm39) D172G possibly damaging Het
Lrp5 A T 19: 3,680,184 (GRCm39) D433E probably damaging Het
Mgam T C 6: 40,745,210 (GRCm39) S1826P possibly damaging Het
Ms4a18 A T 19: 10,986,092 (GRCm39) L206M probably damaging Het
Msln A T 17: 25,969,054 (GRCm39) C444S probably damaging Het
Mta1 A G 12: 113,100,022 (GRCm39) D644G probably damaging Het
Muc5ac G C 7: 141,363,424 (GRCm39) probably benign Het
Naa15 T C 3: 51,366,177 (GRCm39) probably null Het
Nadk A G 4: 155,672,215 (GRCm39) H302R probably benign Het
Neb T A 2: 52,146,124 (GRCm39) N15I Het
Nup153 A T 13: 46,837,404 (GRCm39) S1273T probably benign Het
Ofcc1 A G 13: 40,226,243 (GRCm39) I763T probably damaging Het
Or4b13 T C 2: 90,082,807 (GRCm39) Y175C probably damaging Het
Oxsr1 T C 9: 119,113,727 (GRCm39) I107V probably benign Het
Prmt5 A G 14: 54,748,799 (GRCm39) probably null Het
Ptk2 G A 15: 73,093,658 (GRCm39) P854S possibly damaging Het
Ranbp6 A G 19: 29,790,116 (GRCm39) S79P probably damaging Het
Reln T C 5: 22,104,027 (GRCm39) I3315V probably null Het
Rnf223 T C 4: 156,217,156 (GRCm39) V177A probably benign Het
Slc20a1 C T 2: 129,050,192 (GRCm39) T450M possibly damaging Het
Smg5 C T 3: 88,258,654 (GRCm39) P542S probably benign Het
Sorl1 T A 9: 41,913,930 (GRCm39) Q1333L probably benign Het
Spag5 T A 11: 78,204,017 (GRCm39) probably null Het
Spopfm1 T C 3: 94,173,945 (GRCm39) F314L probably damaging Het
Tdp2 T A 13: 25,022,207 (GRCm39) F209I probably damaging Het
Tgm4 C A 9: 122,869,525 (GRCm39) L35M probably damaging Het
Tma7 A G 9: 108,911,580 (GRCm39) probably benign Het
Tmprss4 A T 9: 45,095,571 (GRCm39) V91D probably damaging Het
Tnfsf4 T A 1: 161,223,268 (GRCm39) M39K probably benign Het
Ttn T A 2: 76,543,912 (GRCm39) T33025S probably benign Het
Tut1 A G 19: 8,943,175 (GRCm39) H754R probably benign Het
Vmn2r27 T G 6: 124,200,904 (GRCm39) Q351P possibly damaging Het
Wee2 G T 6: 40,438,936 (GRCm39) G353V probably benign Het
Zfp747l1 C A 7: 126,983,534 (GRCm39) A523S possibly damaging Het
Zfp879 T A 11: 50,724,222 (GRCm39) H278L probably damaging Het
Other mutations in Capn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Capn1 APN 19 6,057,299 (GRCm39) missense probably damaging 1.00
IGL01314:Capn1 APN 19 6,040,014 (GRCm39) splice site probably benign
R0044:Capn1 UTSW 19 6,064,373 (GRCm39) missense probably benign 0.03
R1496:Capn1 UTSW 19 6,057,528 (GRCm39) critical splice donor site probably null
R1646:Capn1 UTSW 19 6,047,760 (GRCm39) missense probably benign
R1852:Capn1 UTSW 19 6,059,133 (GRCm39) missense possibly damaging 0.95
R1924:Capn1 UTSW 19 6,040,086 (GRCm39) splice site probably null
R2006:Capn1 UTSW 19 6,041,613 (GRCm39) missense probably damaging 1.00
R2109:Capn1 UTSW 19 6,064,388 (GRCm39) missense probably benign 0.01
R3704:Capn1 UTSW 19 6,057,401 (GRCm39) missense probably damaging 1.00
R3705:Capn1 UTSW 19 6,057,401 (GRCm39) missense probably damaging 1.00
R3830:Capn1 UTSW 19 6,044,877 (GRCm39) missense probably damaging 1.00
R4664:Capn1 UTSW 19 6,061,045 (GRCm39) missense probably benign 0.03
R4665:Capn1 UTSW 19 6,061,045 (GRCm39) missense probably benign 0.03
R4666:Capn1 UTSW 19 6,061,045 (GRCm39) missense probably benign 0.03
R4694:Capn1 UTSW 19 6,044,761 (GRCm39) nonsense probably null
R4745:Capn1 UTSW 19 6,043,946 (GRCm39) missense probably benign 0.12
R5103:Capn1 UTSW 19 6,059,140 (GRCm39) missense probably damaging 1.00
R5149:Capn1 UTSW 19 6,040,364 (GRCm39) splice site probably null
R5569:Capn1 UTSW 19 6,063,690 (GRCm39) missense probably benign
R5636:Capn1 UTSW 19 6,064,472 (GRCm39) missense probably benign 0.22
R5906:Capn1 UTSW 19 6,061,451 (GRCm39) missense possibly damaging 0.90
R5907:Capn1 UTSW 19 6,047,827 (GRCm39) missense probably benign
R7038:Capn1 UTSW 19 6,064,349 (GRCm39) missense probably benign 0.23
R7307:Capn1 UTSW 19 6,043,938 (GRCm39) missense possibly damaging 0.91
R7592:Capn1 UTSW 19 6,064,469 (GRCm39) missense probably benign 0.00
R7779:Capn1 UTSW 19 6,044,116 (GRCm39) missense probably benign
R8514:Capn1 UTSW 19 6,047,854 (GRCm39) missense probably damaging 0.98
R8708:Capn1 UTSW 19 6,061,328 (GRCm39) missense probably damaging 1.00
R9452:Capn1 UTSW 19 6,057,287 (GRCm39) missense probably damaging 1.00
Z1176:Capn1 UTSW 19 6,064,308 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGAAAAGGCCCTTGTTCTTGG -3'
(R):5'- CAACAGAGCTTCCTTTCCGC -3'

Sequencing Primer
(F):5'- AAAAGGCCCTTGTTCTTGGTAAGC -3'
(R):5'- AGAGCTTCCTTTCCGCATGTG -3'
Posted On 2019-05-15