Incidental Mutation 'R7091:Ranbp6'
ID 550244
Institutional Source Beutler Lab
Gene Symbol Ranbp6
Ensembl Gene ENSMUSG00000074909
Gene Name RAN binding protein 6
Synonyms
MMRRC Submission 045185-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.295) question?
Stock # R7091 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 29785800-29790374 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 29790116 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 79 (S79P)
Ref Sequence ENSEMBL: ENSMUSP00000100503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099525]
AlphaFold Q8BIV3
Predicted Effect probably damaging
Transcript: ENSMUST00000099525
AA Change: S79P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100503
Gene: ENSMUSG00000074909
AA Change: S79P

DomainStartEndE-ValueType
low complexity region 70 78 N/A INTRINSIC
Pfam:HEAT_2 367 475 2.4e-12 PFAM
Pfam:HEAT_EZ 380 434 1.1e-9 PFAM
Pfam:HEAT 409 438 8.3e-7 PFAM
Pfam:HEAT 916 944 1.1e-6 PFAM
Meta Mutation Damage Score 0.2912 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd18 A C 3: 40,871,173 (GRCm39) I111L probably damaging Het
Ank1 A G 8: 23,548,679 (GRCm39) D11G probably benign Het
Ank2 G T 3: 126,817,000 (GRCm39) Q472K probably damaging Het
Apbb2 A T 5: 66,470,677 (GRCm39) L520H probably damaging Het
Baat T C 4: 49,499,692 (GRCm39) K205E probably benign Het
Brca1 T A 11: 101,417,253 (GRCm39) M294L probably benign Het
Capn1 A G 19: 6,041,586 (GRCm39) M641T possibly damaging Het
Cluap1 T A 16: 3,758,670 (GRCm39) D377E probably benign Het
Col6a2 C T 10: 76,450,925 (GRCm39) V39I unknown Het
Crybg3 T A 16: 59,377,531 (GRCm39) D1241V possibly damaging Het
Dnah10 A G 5: 124,893,206 (GRCm39) K3380R probably benign Het
Eml5 T C 12: 98,768,733 (GRCm39) I1400M probably benign Het
Fancd2 A G 6: 113,522,062 (GRCm39) D219G probably damaging Het
Fras1 A G 5: 96,856,535 (GRCm39) S1973G probably benign Het
Fsd1 G A 17: 56,300,876 (GRCm39) R245H probably damaging Het
G3bp1 T A 11: 55,387,047 (GRCm39) H271Q possibly damaging Het
Glce A G 9: 61,967,870 (GRCm39) V427A probably damaging Het
Gm5141 T C 13: 62,921,778 (GRCm39) T464A possibly damaging Het
Gulp1 T A 1: 44,805,294 (GRCm39) F128I probably damaging Het
H2-T13 T C 17: 36,394,833 (GRCm39) E30G possibly damaging Het
Hcrtr1 A C 4: 130,024,707 (GRCm39) L393W probably damaging Het
Heg1 T C 16: 33,547,090 (GRCm39) S650P probably benign Het
Hspa4l T A 3: 40,736,024 (GRCm39) N569K probably benign Het
Ifi206 A G 1: 173,301,441 (GRCm39) F746L unknown Het
Ivl T C 3: 92,479,549 (GRCm39) D172G possibly damaging Het
Lrp5 A T 19: 3,680,184 (GRCm39) D433E probably damaging Het
Mgam T C 6: 40,745,210 (GRCm39) S1826P possibly damaging Het
Ms4a18 A T 19: 10,986,092 (GRCm39) L206M probably damaging Het
Msln A T 17: 25,969,054 (GRCm39) C444S probably damaging Het
Mta1 A G 12: 113,100,022 (GRCm39) D644G probably damaging Het
Muc5ac G C 7: 141,363,424 (GRCm39) probably benign Het
Naa15 T C 3: 51,366,177 (GRCm39) probably null Het
Nadk A G 4: 155,672,215 (GRCm39) H302R probably benign Het
Neb T A 2: 52,146,124 (GRCm39) N15I Het
Nup153 A T 13: 46,837,404 (GRCm39) S1273T probably benign Het
Ofcc1 A G 13: 40,226,243 (GRCm39) I763T probably damaging Het
Or4b13 T C 2: 90,082,807 (GRCm39) Y175C probably damaging Het
Oxsr1 T C 9: 119,113,727 (GRCm39) I107V probably benign Het
Prmt5 A G 14: 54,748,799 (GRCm39) probably null Het
Ptk2 G A 15: 73,093,658 (GRCm39) P854S possibly damaging Het
Reln T C 5: 22,104,027 (GRCm39) I3315V probably null Het
Rnf223 T C 4: 156,217,156 (GRCm39) V177A probably benign Het
Slc20a1 C T 2: 129,050,192 (GRCm39) T450M possibly damaging Het
Smg5 C T 3: 88,258,654 (GRCm39) P542S probably benign Het
Sorl1 T A 9: 41,913,930 (GRCm39) Q1333L probably benign Het
Spag5 T A 11: 78,204,017 (GRCm39) probably null Het
Spopfm1 T C 3: 94,173,945 (GRCm39) F314L probably damaging Het
Tdp2 T A 13: 25,022,207 (GRCm39) F209I probably damaging Het
Tgm4 C A 9: 122,869,525 (GRCm39) L35M probably damaging Het
Tma7 A G 9: 108,911,580 (GRCm39) probably benign Het
Tmprss4 A T 9: 45,095,571 (GRCm39) V91D probably damaging Het
Tnfsf4 T A 1: 161,223,268 (GRCm39) M39K probably benign Het
Ttn T A 2: 76,543,912 (GRCm39) T33025S probably benign Het
Tut1 A G 19: 8,943,175 (GRCm39) H754R probably benign Het
Vmn2r27 T G 6: 124,200,904 (GRCm39) Q351P possibly damaging Het
Wee2 G T 6: 40,438,936 (GRCm39) G353V probably benign Het
Zfp747l1 C A 7: 126,983,534 (GRCm39) A523S possibly damaging Het
Zfp879 T A 11: 50,724,222 (GRCm39) H278L probably damaging Het
Other mutations in Ranbp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02020:Ranbp6 APN 19 29,787,176 (GRCm39) missense probably benign 0.00
IGL02665:Ranbp6 APN 19 29,790,301 (GRCm39) missense possibly damaging 0.64
IGL02943:Ranbp6 APN 19 29,789,524 (GRCm39) missense possibly damaging 0.91
IGL03018:Ranbp6 APN 19 29,788,789 (GRCm39) missense probably damaging 1.00
IGL03219:Ranbp6 APN 19 29,787,680 (GRCm39) missense probably damaging 1.00
R0137:Ranbp6 UTSW 19 29,787,097 (GRCm39) missense probably benign 0.16
R0412:Ranbp6 UTSW 19 29,789,483 (GRCm39) missense possibly damaging 0.91
R1171:Ranbp6 UTSW 19 29,789,679 (GRCm39) missense probably benign 0.37
R1521:Ranbp6 UTSW 19 29,788,846 (GRCm39) missense probably benign
R1967:Ranbp6 UTSW 19 29,789,900 (GRCm39) nonsense probably null
R2257:Ranbp6 UTSW 19 29,788,949 (GRCm39) missense possibly damaging 0.47
R4490:Ranbp6 UTSW 19 29,787,733 (GRCm39) missense probably damaging 1.00
R4624:Ranbp6 UTSW 19 29,788,263 (GRCm39) nonsense probably null
R4625:Ranbp6 UTSW 19 29,788,263 (GRCm39) nonsense probably null
R4626:Ranbp6 UTSW 19 29,788,263 (GRCm39) nonsense probably null
R4649:Ranbp6 UTSW 19 29,787,721 (GRCm39) missense probably benign 0.23
R4709:Ranbp6 UTSW 19 29,788,984 (GRCm39) missense probably benign 0.00
R4777:Ranbp6 UTSW 19 29,789,037 (GRCm39) missense probably damaging 1.00
R4895:Ranbp6 UTSW 19 29,787,175 (GRCm39) missense possibly damaging 0.93
R5362:Ranbp6 UTSW 19 29,789,128 (GRCm39) missense probably benign 0.30
R5379:Ranbp6 UTSW 19 29,789,083 (GRCm39) missense probably damaging 1.00
R5617:Ranbp6 UTSW 19 29,789,863 (GRCm39) missense probably damaging 1.00
R6264:Ranbp6 UTSW 19 29,790,026 (GRCm39) missense probably benign 0.00
R7234:Ranbp6 UTSW 19 29,789,462 (GRCm39) missense possibly damaging 0.67
R7664:Ranbp6 UTSW 19 29,789,476 (GRCm39) missense possibly damaging 0.90
R7904:Ranbp6 UTSW 19 29,789,813 (GRCm39) missense probably benign
R7915:Ranbp6 UTSW 19 29,790,073 (GRCm39) missense probably benign
R8023:Ranbp6 UTSW 19 29,789,222 (GRCm39) missense possibly damaging 0.81
R8366:Ranbp6 UTSW 19 29,789,299 (GRCm39) missense probably damaging 1.00
R9037:Ranbp6 UTSW 19 29,790,317 (GRCm39) missense probably benign
R9269:Ranbp6 UTSW 19 29,787,388 (GRCm39) missense probably damaging 0.99
R9461:Ranbp6 UTSW 19 29,787,163 (GRCm39) missense possibly damaging 0.64
X0024:Ranbp6 UTSW 19 29,789,840 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAATGGTTAGTGCCACTCTC -3'
(R):5'- AGCTTTGACAGGACGCGATG -3'

Sequencing Primer
(F):5'- CATCTATCAAATTCCTGGCCAGC -3'
(R):5'- AGCAGGAGTTTTACCAGCTTC -3'
Posted On 2019-05-15