Incidental Mutation 'R7091:Ranbp6'
ID550244
Institutional Source Beutler Lab
Gene Symbol Ranbp6
Ensembl Gene ENSMUSG00000074909
Gene NameRAN binding protein 6
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock #R7091 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location29808400-29812974 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29812716 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 79 (S79P)
Ref Sequence ENSEMBL: ENSMUSP00000100503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099525]
Predicted Effect probably damaging
Transcript: ENSMUST00000099525
AA Change: S79P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100503
Gene: ENSMUSG00000074909
AA Change: S79P

DomainStartEndE-ValueType
low complexity region 70 78 N/A INTRINSIC
Pfam:HEAT_2 367 475 2.4e-12 PFAM
Pfam:HEAT_EZ 380 434 1.1e-9 PFAM
Pfam:HEAT 409 438 8.3e-7 PFAM
Pfam:HEAT 916 944 1.1e-6 PFAM
Meta Mutation Damage Score 0.2912 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik C A 7: 127,384,362 A523S possibly damaging Het
Abhd18 A C 3: 40,916,738 I111L probably damaging Het
Ank1 A G 8: 23,058,663 D11G probably benign Het
Ank2 G T 3: 127,023,351 Q472K probably damaging Het
Apbb2 A T 5: 66,313,334 L520H probably damaging Het
Baat T C 4: 49,499,692 K205E probably benign Het
Brca1 T A 11: 101,526,427 M294L probably benign Het
Capn1 A G 19: 5,991,556 M641T possibly damaging Het
Cluap1 T A 16: 3,940,806 D377E probably benign Het
Col6a2 C T 10: 76,615,091 V39I unknown Het
Crybg3 T A 16: 59,557,168 D1241V possibly damaging Het
Dnah10 A G 5: 124,816,142 K3380R probably benign Het
Eml5 T C 12: 98,802,474 I1400M probably benign Het
Fancd2 A G 6: 113,545,101 D219G probably damaging Het
Fras1 A G 5: 96,708,676 S1973G probably benign Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
G3bp1 T A 11: 55,496,221 H271Q possibly damaging Het
Glce A G 9: 62,060,588 V427A probably damaging Het
Gm4778 T C 3: 94,266,638 F314L probably damaging Het
Gm5141 T C 13: 62,773,964 T464A possibly damaging Het
Gulp1 T A 1: 44,766,134 F128I probably damaging Het
H2-Bl T C 17: 36,083,941 E30G possibly damaging Het
Hcrtr1 A C 4: 130,130,914 L393W probably damaging Het
Heg1 T C 16: 33,726,720 S650P probably benign Het
Hspa4l T A 3: 40,781,592 N569K probably benign Het
Ifi206 A G 1: 173,473,875 F746L unknown Het
Ivl T C 3: 92,572,242 D172G possibly damaging Het
Lrp5 A T 19: 3,630,184 D433E probably damaging Het
Mgam T C 6: 40,768,276 S1826P possibly damaging Het
Ms4a18 A T 19: 11,008,728 L206M probably damaging Het
Msln A T 17: 25,750,080 C444S probably damaging Het
Mta1 A G 12: 113,136,402 D644G probably damaging Het
Muc5ac G C 7: 141,809,687 probably benign Het
Naa15 T C 3: 51,458,756 probably null Het
Nadk A G 4: 155,587,758 H302R probably benign Het
Neb T A 2: 52,256,112 N15I Het
Nup153 A T 13: 46,683,928 S1273T probably benign Het
Ofcc1 A G 13: 40,072,767 I763T probably damaging Het
Olfr142 T C 2: 90,252,463 Y175C probably damaging Het
Oxsr1 T C 9: 119,284,661 I107V probably benign Het
Prmt5 A G 14: 54,511,342 probably null Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Reln T C 5: 21,899,029 I3315V probably null Het
Rnf223 T C 4: 156,132,699 V177A probably benign Het
Slc20a1 C T 2: 129,208,272 T450M possibly damaging Het
Smg5 C T 3: 88,351,347 P542S probably benign Het
Sorl1 T A 9: 42,002,634 Q1333L probably benign Het
Spag5 T A 11: 78,313,191 probably null Het
Tdp2 T A 13: 24,838,224 F209I probably damaging Het
Tgm4 C A 9: 123,040,460 L35M probably damaging Het
Tma7 A G 9: 109,082,512 probably benign Het
Tmprss4 A T 9: 45,184,273 V91D probably damaging Het
Tnfsf4 T A 1: 161,395,697 M39K probably benign Het
Ttn T A 2: 76,713,568 T33025S probably benign Het
Tut1 A G 19: 8,965,811 H754R probably benign Het
Vmn2r27 T G 6: 124,223,945 Q351P possibly damaging Het
Wee2 G T 6: 40,462,002 G353V probably benign Het
Zfp879 T A 11: 50,833,395 H278L probably damaging Het
Other mutations in Ranbp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02020:Ranbp6 APN 19 29809776 missense probably benign 0.00
IGL02665:Ranbp6 APN 19 29812901 missense possibly damaging 0.64
IGL02943:Ranbp6 APN 19 29812124 missense possibly damaging 0.91
IGL03018:Ranbp6 APN 19 29811389 missense probably damaging 1.00
IGL03219:Ranbp6 APN 19 29810280 missense probably damaging 1.00
R0137:Ranbp6 UTSW 19 29809697 missense probably benign 0.16
R0412:Ranbp6 UTSW 19 29812083 missense possibly damaging 0.91
R1171:Ranbp6 UTSW 19 29812279 missense probably benign 0.37
R1521:Ranbp6 UTSW 19 29811446 missense probably benign
R1967:Ranbp6 UTSW 19 29812500 nonsense probably null
R2257:Ranbp6 UTSW 19 29811549 missense possibly damaging 0.47
R4490:Ranbp6 UTSW 19 29810333 missense probably damaging 1.00
R4624:Ranbp6 UTSW 19 29810863 nonsense probably null
R4625:Ranbp6 UTSW 19 29810863 nonsense probably null
R4626:Ranbp6 UTSW 19 29810863 nonsense probably null
R4649:Ranbp6 UTSW 19 29810321 missense probably benign 0.23
R4709:Ranbp6 UTSW 19 29811584 missense probably benign 0.00
R4777:Ranbp6 UTSW 19 29811637 missense probably damaging 1.00
R4895:Ranbp6 UTSW 19 29809775 missense possibly damaging 0.93
R5362:Ranbp6 UTSW 19 29811728 missense probably benign 0.30
R5379:Ranbp6 UTSW 19 29811683 missense probably damaging 1.00
R5617:Ranbp6 UTSW 19 29812463 missense probably damaging 1.00
R6264:Ranbp6 UTSW 19 29812626 missense probably benign 0.00
R7234:Ranbp6 UTSW 19 29812062 missense possibly damaging 0.67
R7664:Ranbp6 UTSW 19 29812076 missense possibly damaging 0.90
R7904:Ranbp6 UTSW 19 29812413 missense probably benign
R7987:Ranbp6 UTSW 19 29812413 missense probably benign
R8023:Ranbp6 UTSW 19 29811822 missense possibly damaging 0.81
X0024:Ranbp6 UTSW 19 29812440 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAATGGTTAGTGCCACTCTC -3'
(R):5'- AGCTTTGACAGGACGCGATG -3'

Sequencing Primer
(F):5'- CATCTATCAAATTCCTGGCCAGC -3'
(R):5'- AGCAGGAGTTTTACCAGCTTC -3'
Posted On2019-05-15