Incidental Mutation 'R0615:Tbc1d32'
ID55025
Institutional Source Beutler Lab
Gene Symbol Tbc1d32
Ensembl Gene ENSMUSG00000038122
Gene NameTBC1 domain family, member 32
SynonymsD630037F22Rik, C6orf170, Bromi, b2b2284Clo
MMRRC Submission 038804-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.878) question?
Stock #R0615 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location56014293-56228689 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 56224640 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 81 (D81Y)
Ref Sequence ENSEMBL: ENSMUSP00000097328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099739]
Predicted Effect probably benign
Transcript: ENSMUST00000099739
AA Change: D81Y

PolyPhen 2 Score 0.334 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000097328
Gene: ENSMUSG00000038122
AA Change: D81Y

DomainStartEndE-ValueType
Pfam:BROMI 12 1293 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219385
Meta Mutation Damage Score 0.0805 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a TBC-domain containing protein. Studies of a similar protein in mouse and zebrafish suggest that the encoded protein is involved in sonic hedgehog signaling, and that it interacts with and stabilizes cell cycle-related kinase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a gene trap allele or ENU induced mutation exhibit exencephaly and poor eye development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik C A 11: 29,824,515 R314L probably damaging Het
4933411K16Rik T C 19: 42,052,523 I31T possibly damaging Het
Abca13 A G 11: 9,256,197 I166V probably damaging Het
Acaa2 G T 18: 74,798,446 V238L probably benign Het
Ahsg A T 16: 22,899,055 I296F possibly damaging Het
Aspm T A 1: 139,487,289 V1436D probably damaging Het
Ate1 A T 7: 130,513,833 probably benign Het
Atp1a4 A T 1: 172,232,060 probably benign Het
Aurkc A T 7: 7,002,403 I223L possibly damaging Het
Bckdha G T 7: 25,641,785 D50E probably benign Het
Brf2 C T 8: 27,124,031 E376K probably benign Het
Cdk9 C A 2: 32,709,801 L141F possibly damaging Het
Cgn A C 3: 94,770,714 probably benign Het
Clcn1 G A 6: 42,305,575 V526I probably damaging Het
Cnot2 A G 10: 116,498,236 V343A possibly damaging Het
Commd2 A T 3: 57,646,695 V195D possibly damaging Het
Cubn C T 2: 13,360,252 probably null Het
Eif2ak4 C T 2: 118,436,185 T729M probably damaging Het
Elac1 A T 18: 73,738,883 V347E probably damaging Het
Fam209 T C 2: 172,474,133 S143P probably benign Het
Fam20c G A 5: 138,807,486 R454Q probably damaging Het
Fam214a T A 9: 75,004,288 Y14N probably damaging Het
Faxc C T 4: 21,958,608 S255L probably benign Het
Foxj1 T C 11: 116,334,082 D153G possibly damaging Het
Gm6605 C A 7: 38,448,275 noncoding transcript Het
Lmo7 T A 14: 101,876,859 Y12* probably null Het
Matn3 T G 12: 8,963,594 C425W probably damaging Het
Mmd2 A T 5: 142,564,913 M190K probably benign Het
Morn2 A T 17: 80,295,597 T102S probably damaging Het
Nr3c2 A C 8: 77,185,889 T710P probably benign Het
Nrros C A 16: 32,144,085 L343F probably damaging Het
Ntrk2 C T 13: 59,128,186 Q767* probably null Het
Olfr1297 C T 2: 111,621,919 D52N possibly damaging Het
Olfr92 G C 17: 37,111,455 L176V probably benign Het
Plekhf2 C T 4: 10,991,330 R4H probably benign Het
Ppox A G 1: 171,277,814 probably benign Het
Qprt T A 7: 127,109,076 D61V probably damaging Het
Reln A G 5: 22,010,150 V1101A probably benign Het
Sbno1 T C 5: 124,410,139 N124D probably damaging Het
Scx C T 15: 76,458,095 P165L probably benign Het
Sema6d T C 2: 124,654,135 probably benign Het
Serf2 T C 2: 121,450,855 F92L probably benign Het
Synpo2 A T 3: 123,117,287 N236K probably damaging Het
Terf2 G A 8: 107,082,990 T232I possibly damaging Het
Tpd52l2 A G 2: 181,501,951 E50G probably damaging Het
Tprn A G 2: 25,264,198 E504G probably damaging Het
Tufm G T 7: 126,487,482 R12L probably benign Het
Vmn2r8 A G 5: 108,799,329 F519S probably damaging Het
Vwa8 T C 14: 78,908,150 V89A probably benign Het
Wnt3 T C 11: 103,812,381 I230T possibly damaging Het
Zan A T 5: 137,468,431 F388Y probably damaging Het
Zfp474 C T 18: 52,638,349 L25F probably benign Het
Other mutations in Tbc1d32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Tbc1d32 APN 10 56155765 missense probably damaging 1.00
IGL00535:Tbc1d32 APN 10 56215125 splice site probably benign
IGL00835:Tbc1d32 APN 10 56089846 splice site probably benign
IGL01013:Tbc1d32 APN 10 56201959 splice site probably null
IGL01306:Tbc1d32 APN 10 56180524 missense probably benign 0.14
IGL01452:Tbc1d32 APN 10 56215080 missense possibly damaging 0.71
IGL01668:Tbc1d32 APN 10 56123577 missense probably benign 0.37
IGL02008:Tbc1d32 APN 10 56151775 missense possibly damaging 0.71
IGL02076:Tbc1d32 APN 10 56088403 missense possibly damaging 0.93
IGL02348:Tbc1d32 APN 10 56224619 missense probably benign 0.06
IGL02476:Tbc1d32 APN 10 56198542 missense possibly damaging 0.71
IGL02750:Tbc1d32 APN 10 56198491 missense possibly damaging 0.95
IGL02893:Tbc1d32 APN 10 56017703 missense probably damaging 0.98
ANU23:Tbc1d32 UTSW 10 56180524 missense probably benign 0.14
P0035:Tbc1d32 UTSW 10 56198439 missense probably damaging 1.00
R0118:Tbc1d32 UTSW 10 56017605 missense probably benign 0.02
R0446:Tbc1d32 UTSW 10 56192898 missense possibly damaging 0.93
R0567:Tbc1d32 UTSW 10 56173963 missense possibly damaging 0.71
R0679:Tbc1d32 UTSW 10 56180576 missense probably damaging 0.99
R0943:Tbc1d32 UTSW 10 56161147 missense probably benign
R1432:Tbc1d32 UTSW 10 56017662 missense probably damaging 0.99
R1454:Tbc1d32 UTSW 10 56177479 splice site probably benign
R1708:Tbc1d32 UTSW 10 56151769 missense possibly damaging 0.84
R1834:Tbc1d32 UTSW 10 56017604 missense probably benign 0.00
R1860:Tbc1d32 UTSW 10 56123537 nonsense probably null
R2208:Tbc1d32 UTSW 10 56150792 critical splice donor site probably null
R3012:Tbc1d32 UTSW 10 56173915 missense probably benign 0.08
R3736:Tbc1d32 UTSW 10 56129093 missense probably damaging 0.99
R4184:Tbc1d32 UTSW 10 56224580 missense probably benign 0.15
R4259:Tbc1d32 UTSW 10 56049771 missense probably damaging 0.97
R4617:Tbc1d32 UTSW 10 56170904 missense possibly damaging 0.92
R4700:Tbc1d32 UTSW 10 56224649 missense probably damaging 0.98
R4794:Tbc1d32 UTSW 10 56196836 missense possibly damaging 0.92
R4879:Tbc1d32 UTSW 10 56049029 splice site probably null
R5031:Tbc1d32 UTSW 10 56123531 missense probably damaging 0.98
R5036:Tbc1d32 UTSW 10 56195404 nonsense probably null
R5276:Tbc1d32 UTSW 10 56151818 missense probably damaging 0.99
R5358:Tbc1d32 UTSW 10 56170937 missense possibly damaging 0.93
R5429:Tbc1d32 UTSW 10 56027993 missense probably damaging 0.99
R5435:Tbc1d32 UTSW 10 56040150 missense probably damaging 0.98
R5451:Tbc1d32 UTSW 10 56195475 missense possibly damaging 0.95
R5607:Tbc1d32 UTSW 10 56129150 missense possibly damaging 0.92
R5642:Tbc1d32 UTSW 10 56150877 missense possibly damaging 0.82
R5732:Tbc1d32 UTSW 10 56088393 missense probably damaging 0.99
R5795:Tbc1d32 UTSW 10 56215062 missense possibly damaging 0.71
R5988:Tbc1d32 UTSW 10 56088337 missense probably damaging 0.98
R6054:Tbc1d32 UTSW 10 56162208 missense possibly damaging 0.95
R6103:Tbc1d32 UTSW 10 56150883 missense probably damaging 0.99
R6277:Tbc1d32 UTSW 10 56195429 missense probably benign
R6422:Tbc1d32 UTSW 10 56028061 nonsense probably null
R6508:Tbc1d32 UTSW 10 56224690 missense probably damaging 0.98
R6859:Tbc1d32 UTSW 10 56180530 missense probably damaging 0.98
R6887:Tbc1d32 UTSW 10 56151811 nonsense probably null
R7012:Tbc1d32 UTSW 10 56224724 missense probably damaging 0.99
R7253:Tbc1d32 UTSW 10 56198441 missense probably benign
R7288:Tbc1d32 UTSW 10 56051387 critical splice donor site probably null
R7599:Tbc1d32 UTSW 10 56151833 missense possibly damaging 0.92
R8338:Tbc1d32 UTSW 10 56028077 missense possibly damaging 0.85
R8814:Tbc1d32 UTSW 10 56196592 missense not run
Z1188:Tbc1d32 UTSW 10 56170881 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATCTGCACAGGTAGGAAGCTAGAGGA -3'
(R):5'- CAAAGAGTTATGGGCTGGAGGTGTTC -3'

Sequencing Primer
(F):5'- AGCTCATGGAAGGGGGAAG -3'
(R):5'- TTTCTTAATGACAAGGCAAAGCCAC -3'
Posted On2013-07-11