Mutagenetix > Incidental Mutation

Incidental Mutation 'R0615:Tbc1d32'

55025

Institutional Source

Beutler Lab

Gene Symbol

Tbc1d32

Ensembl Gene

ENSMUSG00000038122

Gene Name

TBC1 domain family, member 32

Synonyms

D630037F22Rik, C6orf170, Bromi, b2b2284Clo

MMRRC Submission

038804-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.925) question?

Stock #

R0615 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

56014293-56228689 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 56224640 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Tyrosine at position 81 (D81Y)

Ref Sequence

ENSEMBL: ENSMUSP00000097328 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099739]

AlphaFold

Q3URV1

Predicted Effect

probably benign
Transcript: ENSMUST00000099739
AA Change: D81Y

PolyPhen 2 Score 0.334 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000097328
Gene: ENSMUSG00000038122
AA Change: D81Y

Domain	Start	End	E-Value	Type
Pfam:BROMI	12	1293	N/A	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219385

Meta Mutation Damage Score

0.0805

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.4%
20x: 94.8%

Validation Efficiency

100% (57/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a TBC-domain containing protein. Studies of a similar protein in mouse and zebrafish suggest that the encoded protein is involved in sonic hedgehog signaling, and that it interacts with and stabilizes cell cycle-related kinase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a gene trap allele or ENU induced mutation exhibit exencephaly and poor eye development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931440F15Rik	C	A	11: 29,824,515	R314L	probably damaging	Het
4933411K16Rik	T	C	19: 42,052,523	I31T	possibly damaging	Het
Abca13	A	G	11: 9,256,197	I166V	probably damaging	Het
Acaa2	G	T	18: 74,798,446	V238L	probably benign	Het
Ahsg	A	T	16: 22,899,055	I296F	possibly damaging	Het
Aspm	T	A	1: 139,487,289	V1436D	probably damaging	Het
Ate1	A	T	7: 130,513,833		probably benign	Het
Atp1a4	A	T	1: 172,232,060		probably benign	Het
Aurkc	A	T	7: 7,002,403	I223L	possibly damaging	Het
Bckdha	G	T	7: 25,641,785	D50E	probably benign	Het
Brf2	C	T	8: 27,124,031	E376K	probably benign	Het
Cdk9	C	A	2: 32,709,801	L141F	possibly damaging	Het
Cgn	A	C	3: 94,770,714		probably benign	Het
Clcn1	G	A	6: 42,305,575	V526I	probably damaging	Het
Cnot2	A	G	10: 116,498,236	V343A	possibly damaging	Het
Commd2	A	T	3: 57,646,695	V195D	possibly damaging	Het
Cubn	C	T	2: 13,360,252		probably null	Het
Eif2ak4	C	T	2: 118,436,185	T729M	probably damaging	Het
Elac1	A	T	18: 73,738,883	V347E	probably damaging	Het
Fam209	T	C	2: 172,474,133	S143P	probably benign	Het
Fam20c	G	A	5: 138,807,486	R454Q	probably damaging	Het
Fam214a	T	A	9: 75,004,288	Y14N	probably damaging	Het
Faxc	C	T	4: 21,958,608	S255L	probably benign	Het
Foxj1	T	C	11: 116,334,082	D153G	possibly damaging	Het
Gm6605	C	A	7: 38,448,275		noncoding transcript	Het
Lmo7	T	A	14: 101,876,859	Y12*	probably null	Het
Matn3	T	G	12: 8,963,594	C425W	probably damaging	Het
Mmd2	A	T	5: 142,564,913	M190K	probably benign	Het
Morn2	A	T	17: 80,295,597	T102S	probably damaging	Het
Nr3c2	A	C	8: 77,185,889	T710P	probably benign	Het
Nrros	C	A	16: 32,144,085	L343F	probably damaging	Het
Ntrk2	C	T	13: 59,128,186	Q767*	probably null	Het
Olfr1297	C	T	2: 111,621,919	D52N	possibly damaging	Het
Olfr92	G	C	17: 37,111,455	L176V	probably benign	Het
Plekhf2	C	T	4: 10,991,330	R4H	probably benign	Het
Ppox	A	G	1: 171,277,814		probably benign	Het
Qprt	T	A	7: 127,109,076	D61V	probably damaging	Het
Reln	A	G	5: 22,010,150	V1101A	probably benign	Het
Sbno1	T	C	5: 124,410,139	N124D	probably damaging	Het
Scx	C	T	15: 76,458,095	P165L	probably benign	Het
Sema6d	T	C	2: 124,654,135		probably benign	Het
Serf2	T	C	2: 121,450,855	F92L	probably benign	Het
Synpo2	A	T	3: 123,117,287	N236K	probably damaging	Het
Terf2	G	A	8: 107,082,990	T232I	possibly damaging	Het
Tpd52l2	A	G	2: 181,501,951	E50G	probably damaging	Het
Tprn	A	G	2: 25,264,198	E504G	probably damaging	Het
Tufm	G	T	7: 126,487,482	R12L	probably benign	Het
Vmn2r8	A	G	5: 108,799,329	F519S	probably damaging	Het
Vwa8	T	C	14: 78,908,150	V89A	probably benign	Het
Wnt3	T	C	11: 103,812,381	I230T	possibly damaging	Het
Zan	A	T	5: 137,468,431	F388Y	probably damaging	Het
Zfp474	C	T	18: 52,638,349	L25F	probably benign	Het

Other mutations in Tbc1d32

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00490:Tbc1d32	APN	10	56155765	missense	probably damaging	1.00
IGL00535:Tbc1d32	APN	10	56215125	splice site	probably benign
IGL00835:Tbc1d32	APN	10	56089846	splice site	probably benign
IGL01013:Tbc1d32	APN	10	56201959	splice site	probably null
IGL01306:Tbc1d32	APN	10	56180524	missense	probably benign	0.14
IGL01452:Tbc1d32	APN	10	56215080	missense	possibly damaging	0.71
IGL01668:Tbc1d32	APN	10	56123577	missense	probably benign	0.37
IGL02008:Tbc1d32	APN	10	56151775	missense	possibly damaging	0.71
IGL02076:Tbc1d32	APN	10	56088403	missense	possibly damaging	0.93
IGL02348:Tbc1d32	APN	10	56224619	missense	probably benign	0.06
IGL02476:Tbc1d32	APN	10	56198542	missense	possibly damaging	0.71
IGL02750:Tbc1d32	APN	10	56198491	missense	possibly damaging	0.95
IGL02893:Tbc1d32	APN	10	56017703	missense	probably damaging	0.98
ANU23:Tbc1d32	UTSW	10	56180524	missense	probably benign	0.14
P0035:Tbc1d32	UTSW	10	56198439	missense	probably damaging	1.00
R0118:Tbc1d32	UTSW	10	56017605	missense	probably benign	0.02
R0446:Tbc1d32	UTSW	10	56192898	missense	possibly damaging	0.93
R0567:Tbc1d32	UTSW	10	56173963	missense	possibly damaging	0.71
R0679:Tbc1d32	UTSW	10	56180576	missense	probably damaging	0.99
R0943:Tbc1d32	UTSW	10	56161147	missense	probably benign
R1432:Tbc1d32	UTSW	10	56017662	missense	probably damaging	0.99
R1454:Tbc1d32	UTSW	10	56177479	splice site	probably benign
R1708:Tbc1d32	UTSW	10	56151769	missense	possibly damaging	0.84
R1834:Tbc1d32	UTSW	10	56017604	missense	probably benign	0.00
R1860:Tbc1d32	UTSW	10	56123537	nonsense	probably null
R2208:Tbc1d32	UTSW	10	56150792	critical splice donor site	probably null
R3012:Tbc1d32	UTSW	10	56173915	missense	probably benign	0.08
R3736:Tbc1d32	UTSW	10	56129093	missense	probably damaging	0.99
R4184:Tbc1d32	UTSW	10	56224580	missense	probably benign	0.15
R4259:Tbc1d32	UTSW	10	56049771	missense	probably damaging	0.97
R4617:Tbc1d32	UTSW	10	56170904	missense	possibly damaging	0.92
R4700:Tbc1d32	UTSW	10	56224649	missense	probably damaging	0.98
R4794:Tbc1d32	UTSW	10	56196836	missense	possibly damaging	0.92
R4879:Tbc1d32	UTSW	10	56049029	splice site	probably null
R5031:Tbc1d32	UTSW	10	56123531	missense	probably damaging	0.98
R5036:Tbc1d32	UTSW	10	56195404	nonsense	probably null
R5276:Tbc1d32	UTSW	10	56151818	missense	probably damaging	0.99
R5358:Tbc1d32	UTSW	10	56170937	missense	possibly damaging	0.93
R5429:Tbc1d32	UTSW	10	56027993	missense	probably damaging	0.99
R5435:Tbc1d32	UTSW	10	56040150	missense	probably damaging	0.98
R5451:Tbc1d32	UTSW	10	56195475	missense	possibly damaging	0.95
R5607:Tbc1d32	UTSW	10	56129150	missense	possibly damaging	0.92
R5642:Tbc1d32	UTSW	10	56150877	missense	possibly damaging	0.82
R5732:Tbc1d32	UTSW	10	56088393	missense	probably damaging	0.99
R5795:Tbc1d32	UTSW	10	56215062	missense	possibly damaging	0.71
R5988:Tbc1d32	UTSW	10	56088337	missense	probably damaging	0.98
R6054:Tbc1d32	UTSW	10	56162208	missense	possibly damaging	0.95
R6103:Tbc1d32	UTSW	10	56150883	missense	probably damaging	0.99
R6277:Tbc1d32	UTSW	10	56195429	missense	probably benign
R6422:Tbc1d32	UTSW	10	56028061	nonsense	probably null
R6508:Tbc1d32	UTSW	10	56224690	missense	probably damaging	0.98
R6859:Tbc1d32	UTSW	10	56180530	missense	probably damaging	0.98
R6887:Tbc1d32	UTSW	10	56151811	nonsense	probably null
R7012:Tbc1d32	UTSW	10	56224724	missense	probably damaging	0.99
R7253:Tbc1d32	UTSW	10	56198441	missense	probably benign
R7288:Tbc1d32	UTSW	10	56051387	critical splice donor site	probably null
R7599:Tbc1d32	UTSW	10	56151833	missense	possibly damaging	0.92
R8338:Tbc1d32	UTSW	10	56028077	missense	possibly damaging	0.85
R8814:Tbc1d32	UTSW	10	56196592	missense	possibly damaging	0.93
R8864:Tbc1d32	UTSW	10	56087559	missense	probably benign	0.01
R9018:Tbc1d32	UTSW	10	56072597	missense	probably benign	0.02
R9030:Tbc1d32	UTSW	10	56161145	missense	possibly damaging	0.92
R9530:Tbc1d32	UTSW	10	56196411	missense	probably damaging	0.98
R9616:Tbc1d32	UTSW	10	56161150	missense	possibly damaging	0.85
Z1188:Tbc1d32	UTSW	10	56170881	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ATCTGCACAGGTAGGAAGCTAGAGGA -3'
(R):5'- CAAAGAGTTATGGGCTGGAGGTGTTC -3'

Sequencing Primer
(F):5'- AGCTCATGGAAGGGGGAAG -3'
(R):5'- TTTCTTAATGACAAGGCAAAGCCAC -3'

Posted On

2013-07-11