Incidental Mutation 'R7092:Rpe65'
ID 550266
Institutional Source Beutler Lab
Gene Symbol Rpe65
Ensembl Gene ENSMUSG00000028174
Gene Name retinal pigment epithelium 65
Synonyms rd12, Mord1, A930029L06Rik
MMRRC Submission 045186-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.184) question?
Stock # R7092 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 159304812-159330958 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 159321228 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 347 (R347C)
Ref Sequence ENSEMBL: ENSMUSP00000029824 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029824] [ENSMUST00000196999]
AlphaFold Q91ZQ5
Predicted Effect probably damaging
Transcript: ENSMUST00000029824
AA Change: R347C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029824
Gene: ENSMUSG00000028174
AA Change: R347C

DomainStartEndE-ValueType
Pfam:RPE65 15 532 1.4e-111 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000196999
AA Change: R347C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143654
Gene: ENSMUSG00000028174
AA Change: R347C

DomainStartEndE-ValueType
Pfam:RPE65 15 532 1.4e-111 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (88/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is located in the retinal pigment epithelium and is involved in the production of 11-cis retinal and in visual pigment regeneration. There are two forms of this protein, a soluble form called sRPE65, and a palmitoylated, membrane-bound form known as mRPE65. mRPE65 serves as the palmitoyl donor for lecithin retinol acyl transferase (LRAT), the enzyme that catalyzes the vitamin A to all trans retinol step of the chromophore regeneration process. Both mRPE65 and sRPE65 also serve as regulatory proteins, with the ratio and concentrations of these molecules playing a role in the inhibition of 11-cis retinal synthesis. Mutations in this gene have been associated with Leber congenital amaurosis type 2 (LCA2) and retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit disorganized outer segment discs, reduced rod function, lack of rhodopsin and lipofuscin flurophores, and over-accumulation of all-trans-retinyl esters in the retinal pigment epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik C T 3: 137,889,506 (GRCm39) C37Y probably benign Het
A430005L14Rik T A 4: 154,045,451 (GRCm39) probably null Het
Aadacl2fm3 T C 3: 59,768,500 (GRCm39) F10S probably benign Het
Abca4 C G 3: 121,932,218 (GRCm39) P1499A probably damaging Het
Adcy8 T C 15: 64,743,619 (GRCm39) N330D possibly damaging Het
Arfgef1 A G 1: 10,223,901 (GRCm39) Y1466H probably damaging Het
Asz1 A C 6: 18,071,818 (GRCm39) probably null Het
Atad5 T A 11: 80,011,546 (GRCm39) N1307K possibly damaging Het
B4galnt4 C A 7: 140,648,549 (GRCm39) F688L probably damaging Het
Birc6 C T 17: 74,953,740 (GRCm39) T3349I probably damaging Het
Ccp110 C A 7: 118,334,494 (GRCm39) A989E probably benign Het
Ccser2 A G 14: 36,662,612 (GRCm39) S191P probably benign Het
Cdca2 A G 14: 67,944,800 (GRCm39) probably null Het
Cdcp1 T A 9: 123,012,678 (GRCm39) T290S probably benign Het
Cep43 C T 17: 8,391,802 (GRCm39) P161S probably benign Het
Clec2m T A 6: 129,299,963 (GRCm39) T172S probably benign Het
Cnnm1 T C 19: 43,430,387 (GRCm39) Y502H probably damaging Het
Cyba T G 8: 123,154,437 (GRCm39) T29P probably damaging Het
Dcaf12 A T 4: 41,301,366 (GRCm39) I190N probably damaging Het
Depp1 C A 6: 116,628,749 (GRCm39) P31T probably damaging Het
Epha1 T C 6: 42,341,179 (GRCm39) T512A probably benign Het
Fancg G A 4: 43,004,831 (GRCm39) P454L probably benign Het
Fasn A C 11: 120,710,946 (GRCm39) V268G possibly damaging Het
Fip1l1 T A 5: 74,697,504 (GRCm39) L42Q probably damaging Het
Fjx1 A G 2: 102,281,101 (GRCm39) L278P possibly damaging Het
Fsd1 G A 17: 56,300,876 (GRCm39) R245H probably damaging Het
Fundc2b T A 3: 40,856,809 (GRCm39) D22V possibly damaging Het
Gm1527 T A 3: 28,968,696 (GRCm39) probably null Het
Gng3 T A 19: 8,815,611 (GRCm39) M42L probably benign Het
Gsdmc2 T A 15: 63,696,947 (GRCm39) Q408L probably damaging Het
Gtpbp3 T A 8: 71,944,909 (GRCm39) I388K probably benign Het
Hmcn1 A T 1: 150,479,997 (GRCm39) W4534R probably damaging Het
Inhca G A 9: 103,158,242 (GRCm39) S106L possibly damaging Het
Ist1 A T 8: 110,409,228 (GRCm39) probably null Het
Kifbp C A 10: 62,414,079 (GRCm39) K26N probably damaging Het
Kyat3 T C 3: 142,435,556 (GRCm39) I276T probably damaging Het
Lipm C T 19: 34,098,758 (GRCm39) P411S possibly damaging Het
Lipo3 T C 19: 33,591,092 (GRCm39) probably null Het
Lrrc9 C A 12: 72,510,238 (GRCm39) Q446K possibly damaging Het
Mfsd4a G T 1: 131,995,401 (GRCm39) T77N probably benign Het
Mmp1b T A 9: 7,386,981 (GRCm39) D77V probably damaging Het
Mrgprb4 A G 7: 47,847,984 (GRCm39) S315P probably benign Het
Mroh2b C A 15: 4,964,160 (GRCm39) N887K possibly damaging Het
Mto1 A G 9: 78,377,955 (GRCm39) K599R probably benign Het
Muc5ac G C 7: 141,363,424 (GRCm39) probably benign Het
Muc5ac T C 7: 141,363,385 (GRCm39) probably benign Het
Mylk2 A G 2: 152,757,110 (GRCm39) N295S probably benign Het
Nr1i3 G A 1: 171,041,747 (GRCm39) probably null Het
Nup107 T C 10: 117,626,399 (GRCm39) K25E probably damaging Het
Odc1 G A 12: 17,598,314 (GRCm39) V152I possibly damaging Het
Or13a20 G A 7: 140,232,150 (GRCm39) G86D probably benign Het
Or1l4b T A 2: 37,036,623 (GRCm39) M133K probably damaging Het
Or5m10b A T 2: 85,698,951 (GRCm39) N5I probably damaging Het
Or7g16 G A 9: 18,727,353 (GRCm39) P79L probably damaging Het
Pde1b G T 15: 103,435,458 (GRCm39) V438L probably benign Het
Pde4b G A 4: 102,459,048 (GRCm39) V523M probably damaging Het
Pdgfc C T 3: 81,111,659 (GRCm39) P205S probably damaging Het
Per2 A G 1: 91,349,153 (GRCm39) S1073P probably damaging Het
Plekhg5 C T 4: 152,198,965 (GRCm39) T1051I probably damaging Het
Ppme1 A T 7: 100,021,029 (GRCm39) M1K probably null Het
Prokr2 A T 2: 132,223,236 (GRCm39) V102D possibly damaging Het
Ptk2 G A 15: 73,093,658 (GRCm39) P854S possibly damaging Het
Ptprh C A 7: 4,583,860 (GRCm39) probably null Het
Rbsn T C 6: 92,166,607 (GRCm39) N679S probably damaging Het
Rce1 T C 19: 4,673,118 (GRCm39) T303A probably damaging Het
Rnf123 C A 9: 107,945,799 (GRCm39) R329L probably benign Het
Robo2 T A 16: 73,753,531 (GRCm39) N782I probably damaging Het
Ror2 A C 13: 53,264,272 (GRCm39) V940G probably benign Het
Rrp8 A T 7: 105,383,316 (GRCm39) F317I probably damaging Het
Sidt1 A G 16: 44,120,192 (GRCm39) V163A possibly damaging Het
Sin3b T C 8: 73,474,498 (GRCm39) probably null Het
Slamf1 A G 1: 171,604,757 (GRCm39) T176A probably benign Het
Slc12a4 G T 8: 106,671,855 (GRCm39) A922D probably damaging Het
Slco1a5 T A 6: 142,194,401 (GRCm39) Q414L probably benign Het
Snx11 C A 11: 96,663,665 (GRCm39) R58L probably damaging Het
Sp9 A G 2: 73,104,115 (GRCm39) D223G probably damaging Het
Sptbn1 T C 11: 30,087,119 (GRCm39) I1107V possibly damaging Het
Stap2 T C 17: 56,309,954 (GRCm39) R66G probably benign Het
Synrg T G 11: 83,899,683 (GRCm39) F552V possibly damaging Het
Trim60 C T 8: 65,453,700 (GRCm39) R183H probably benign Het
Ttn T C 2: 76,733,760 (GRCm39) D4505G unknown Het
Ubxn4 A G 1: 128,179,959 (GRCm39) I34M probably benign Het
Vac14 T A 8: 111,442,128 (GRCm39) M702K probably damaging Het
Vmn1r43 T C 6: 89,846,885 (GRCm39) I200M probably benign Het
Vmn2r108 T A 17: 20,701,338 (GRCm39) Y54F probably benign Het
Vps13b T C 15: 35,640,780 (GRCm39) Y1382H probably damaging Het
Wdr72 T C 9: 74,117,754 (GRCm39) I834T probably damaging Het
Zfp970 T A 2: 177,167,085 (GRCm39) C220S probably damaging Het
Zkscan5 T G 5: 145,156,899 (GRCm39) I467S probably benign Het
Other mutations in Rpe65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Rpe65 APN 3 159,320,179 (GRCm39) missense probably damaging 0.99
IGL01446:Rpe65 APN 3 159,306,042 (GRCm39) splice site probably benign
IGL01815:Rpe65 APN 3 159,310,167 (GRCm39) splice site probably null
IGL02085:Rpe65 APN 3 159,321,283 (GRCm39) missense probably benign 0.00
IGL02232:Rpe65 APN 3 159,309,988 (GRCm39) missense possibly damaging 0.93
IGL02248:Rpe65 APN 3 159,330,342 (GRCm39) missense probably damaging 1.00
IGL02645:Rpe65 APN 3 159,312,128 (GRCm39) missense probably damaging 0.99
IGL02711:Rpe65 APN 3 159,328,514 (GRCm39) missense possibly damaging 0.84
IGL02982:Rpe65 APN 3 159,305,998 (GRCm39) missense probably damaging 0.99
IGL03280:Rpe65 APN 3 159,309,978 (GRCm39) missense probably damaging 0.96
IGL03350:Rpe65 APN 3 159,320,154 (GRCm39) missense possibly damaging 0.75
IGL03356:Rpe65 APN 3 159,321,214 (GRCm39) missense possibly damaging 0.89
I1329:Rpe65 UTSW 3 159,330,360 (GRCm39) missense probably benign 0.35
R0571:Rpe65 UTSW 3 159,305,986 (GRCm39) missense probably damaging 1.00
R0905:Rpe65 UTSW 3 159,307,220 (GRCm39) missense possibly damaging 0.95
R1024:Rpe65 UTSW 3 159,312,122 (GRCm39) missense probably benign 0.07
R1597:Rpe65 UTSW 3 159,320,421 (GRCm39) missense probably damaging 0.97
R1657:Rpe65 UTSW 3 159,320,085 (GRCm39) missense probably damaging 0.97
R1778:Rpe65 UTSW 3 159,328,485 (GRCm39) missense probably damaging 1.00
R1970:Rpe65 UTSW 3 159,321,307 (GRCm39) missense probably benign
R2259:Rpe65 UTSW 3 159,321,208 (GRCm39) missense probably damaging 1.00
R3012:Rpe65 UTSW 3 159,310,200 (GRCm39) missense possibly damaging 0.61
R3923:Rpe65 UTSW 3 159,310,037 (GRCm39) missense probably benign 0.16
R3975:Rpe65 UTSW 3 159,310,222 (GRCm39) missense probably damaging 1.00
R4204:Rpe65 UTSW 3 159,310,047 (GRCm39) missense probably damaging 0.99
R4825:Rpe65 UTSW 3 159,330,318 (GRCm39) missense probably benign
R4924:Rpe65 UTSW 3 159,328,268 (GRCm39) missense probably benign 0.01
R5269:Rpe65 UTSW 3 159,309,984 (GRCm39) missense probably benign 0.07
R5324:Rpe65 UTSW 3 159,310,041 (GRCm39) missense possibly damaging 0.94
R5441:Rpe65 UTSW 3 159,310,038 (GRCm39) missense probably damaging 1.00
R5854:Rpe65 UTSW 3 159,321,313 (GRCm39) missense probably benign
R5907:Rpe65 UTSW 3 159,321,319 (GRCm39) critical splice donor site probably null
R6149:Rpe65 UTSW 3 159,319,780 (GRCm39) missense probably benign
R6660:Rpe65 UTSW 3 159,320,345 (GRCm39) missense probably damaging 0.98
R6830:Rpe65 UTSW 3 159,319,805 (GRCm39) missense probably benign 0.06
R7025:Rpe65 UTSW 3 159,328,322 (GRCm39) missense probably damaging 1.00
R7203:Rpe65 UTSW 3 159,328,491 (GRCm39) missense probably damaging 0.99
R7366:Rpe65 UTSW 3 159,330,366 (GRCm39) missense probably benign 0.13
R7537:Rpe65 UTSW 3 159,310,246 (GRCm39) missense probably damaging 0.98
R7679:Rpe65 UTSW 3 159,310,030 (GRCm39) missense probably damaging 1.00
R8044:Rpe65 UTSW 3 159,320,342 (GRCm39) missense probably benign
R8179:Rpe65 UTSW 3 159,330,336 (GRCm39) missense probably benign 0.06
R8409:Rpe65 UTSW 3 159,319,785 (GRCm39) missense probably benign 0.01
R8558:Rpe65 UTSW 3 159,320,429 (GRCm39) missense probably damaging 1.00
R9042:Rpe65 UTSW 3 159,321,292 (GRCm39) missense probably damaging 1.00
R9483:Rpe65 UTSW 3 159,328,318 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGGTTGTGACCTAAGGAAC -3'
(R):5'- GGGAATCACTGGGTCTGTAG -3'

Sequencing Primer
(F):5'- CCAACAGTGGTAGAGCACTTGTC -3'
(R):5'- GTGGAAGTCACCCTTTCTAAATCAC -3'
Posted On 2019-05-15