Mutagenetix > Incidental Mutation

Incidental Mutation 'R7092:Rpe65'

550266

Institutional Source

Beutler Lab

Gene Symbol

Rpe65

Ensembl Gene

ENSMUSG00000028174

Gene Name

retinal pigment epithelium 65

Synonyms

A930029L06Rik, Mord1, rd12

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.243) question?

Stock #

R7092 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

159599175-159625321 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 159615591 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 347 (R347C)

Ref Sequence

ENSEMBL: ENSMUSP00000029824 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029824] [ENSMUST00000196999]

AlphaFold

Q91ZQ5

Predicted Effect

probably damaging
Transcript: ENSMUST00000029824
AA Change: R347C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000029824
Gene: ENSMUSG00000028174
AA Change: R347C

Domain	Start	End	E-Value	Type
Pfam:RPE65	15	532	1.4e-111	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000196999
AA Change: R347C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000143654
Gene: ENSMUSG00000028174
AA Change: R347C

Domain	Start	End	E-Value	Type
Pfam:RPE65	15	532	1.4e-111	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

99% (88/89)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is located in the retinal pigment epithelium and is involved in the production of 11-cis retinal and in visual pigment regeneration. There are two forms of this protein, a soluble form called sRPE65, and a palmitoylated, membrane-bound form known as mRPE65. mRPE65 serves as the palmitoyl donor for lecithin retinol acyl transferase (LRAT), the enzyme that catalyzes the vitamin A to all trans retinol step of the chromophore regeneration process. Both mRPE65 and sRPE65 also serve as regulatory proteins, with the ratio and concentrations of these molecules playing a role in the inhibition of 11-cis retinal synthesis. Mutations in this gene have been associated with Leber congenital amaurosis type 2 (LCA2) and retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit disorganized outer segment discs, reduced rod function, lack of rhodopsin and lipofuscin flurophores, and over-accumulation of all-trans-retinyl esters in the retinal pigment epithelium. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1300017J02Rik	G	A	9: 103,281,043	S106L	possibly damaging	Het
1700034I23Rik	T	A	3: 40,902,374	D22V	possibly damaging	Het
4922502D21Rik	T	A	6: 129,323,000	T172S	probably benign	Het
4930579F01Rik	C	T	3: 138,183,745	C37Y	probably benign	Het
8430408G22Rik	C	A	6: 116,651,788	P31T	probably damaging	Het
A430005L14Rik	T	A	4: 153,960,994		probably null	Het
Abca4	C	G	3: 122,138,569	P1499A	probably damaging	Het
Adcy8	T	C	15: 64,871,770	N330D	possibly damaging	Het
Arfgef1	A	G	1: 10,153,676	Y1466H	probably damaging	Het
Asz1	A	C	6: 18,071,819		probably null	Het
Atad5	T	A	11: 80,120,720	N1307K	possibly damaging	Het
B4galnt4	C	A	7: 141,068,636	F688L	probably damaging	Het
Birc6	C	T	17: 74,646,745	T3349I	probably damaging	Het
Ccp110	C	A	7: 118,735,271	A989E	probably benign	Het
Ccser2	A	G	14: 36,940,655	S191P	probably benign	Het
Cdca2	A	G	14: 67,707,351		probably null	Het
Cdcp1	T	A	9: 123,183,613	T290S	probably benign	Het
Cnnm1	T	C	19: 43,441,948	Y502H	probably damaging	Het
Cyba	T	G	8: 122,427,698	T29P	probably damaging	Het
Dcaf12	A	T	4: 41,301,366	I190N	probably damaging	Het
Epha1	T	C	6: 42,364,245	T512A	probably benign	Het
Fancg	G	A	4: 43,004,831	P454L	probably benign	Het
Fasn	A	C	11: 120,820,120	V268G	possibly damaging	Het
Fgfr1op	C	T	17: 8,172,970	P161S	probably benign	Het
Fip1l1	T	A	5: 74,536,843	L42Q	probably damaging	Het
Fjx1	A	G	2: 102,450,756	L278P	possibly damaging	Het
Fsd1	G	A	17: 55,993,876	R245H	probably damaging	Het
Gm1527	T	A	3: 28,914,547		probably null	Het
Gm8298	T	C	3: 59,861,079	F10S	probably benign	Het
Gng3	T	A	19: 8,838,247	M42L	probably benign	Het
Gsdmc2	T	A	15: 63,825,098	Q408L	probably damaging	Het
Gtpbp3	T	A	8: 71,492,265	I388K	probably benign	Het
Hmcn1	A	T	1: 150,604,246	W4534R	probably damaging	Het
Ist1	A	T	8: 109,682,596		probably null	Het
Kif1bp	C	A	10: 62,578,300	K26N	probably damaging	Het
Kyat3	T	C	3: 142,729,795	I276T	probably damaging	Het
Lipm	C	T	19: 34,121,358	P411S	possibly damaging	Het
Lipo3	T	C	19: 33,613,692		probably null	Het
Lrrc9	C	A	12: 72,463,464	Q446K	possibly damaging	Het
Mfsd4a	G	T	1: 132,067,663	T77N	probably benign	Het
Mmp1b	T	A	9: 7,386,981	D77V	probably damaging	Het
Mrgprb4	A	G	7: 48,198,236	S315P	probably benign	Het
Mroh2b	C	A	15: 4,934,678	N887K	possibly damaging	Het
Mto1	A	G	9: 78,470,673	K599R	probably benign	Het
Muc5ac	T	C	7: 141,809,648		probably benign	Het
Muc5ac	G	C	7: 141,809,687		probably benign	Het
Mylk2	A	G	2: 152,915,190	N295S	probably benign	Het
Nr1i3	G	A	1: 171,214,178		probably null	Het
Nup107	T	C	10: 117,790,494	K25E	probably damaging	Het
Odc1	G	A	12: 17,548,313	V152I	possibly damaging	Het
Olfr1022	A	T	2: 85,868,607	N5I	probably damaging	Het
Olfr364-ps1	T	A	2: 37,146,611	M133K	probably damaging	Het
Olfr53	G	A	7: 140,652,237	G86D	probably benign	Het
Olfr828	G	A	9: 18,816,057	P79L	probably damaging	Het
Pde1b	G	T	15: 103,527,031	V438L	probably benign	Het
Pde4b	G	A	4: 102,601,851	V523M	probably damaging	Het
Pdgfc	C	T	3: 81,204,352	P205S	probably damaging	Het
Per2	A	G	1: 91,421,431	S1073P	probably damaging	Het
Plekhg5	C	T	4: 152,114,508	T1051I	probably damaging	Het
Ppme1	A	T	7: 100,371,822	M1K	probably null	Het
Prokr2	A	T	2: 132,381,316	V102D	possibly damaging	Het
Ptk2	G	A	15: 73,221,809	P854S	possibly damaging	Het
Ptprh	C	A	7: 4,580,861		probably null	Het
Rbsn	T	C	6: 92,189,626	N679S	probably damaging	Het
Rce1	T	C	19: 4,623,090	T303A	probably damaging	Het
Rnf123	C	A	9: 108,068,600	R329L	probably benign	Het
Robo2	T	A	16: 73,956,643	N782I	probably damaging	Het
Ror2	A	C	13: 53,110,236	V940G	probably benign	Het
Rrp8	A	T	7: 105,734,109	F317I	probably damaging	Het
Sidt1	A	G	16: 44,299,829	V163A	possibly damaging	Het
Sin3b	T	C	8: 72,747,870		probably null	Het
Slamf1	A	G	1: 171,777,189	T176A	probably benign	Het
Slc12a4	G	T	8: 105,945,223	A922D	probably damaging	Het
Slco1a5	T	A	6: 142,248,675	Q414L	probably benign	Het
Snx11	C	A	11: 96,772,839	R58L	probably damaging	Het
Sp9	A	G	2: 73,273,771	D223G	probably damaging	Het
Sptbn1	T	C	11: 30,137,119	I1107V	possibly damaging	Het
Stap2	T	C	17: 56,002,954	R66G	probably benign	Het
Synrg	T	G	11: 84,008,857	F552V	possibly damaging	Het
Trim60	C	T	8: 65,001,048	R183H	probably benign	Het
Ttn	T	C	2: 76,903,416	D4505G	unknown	Het
Ubxn4	A	G	1: 128,252,222	I34M	probably benign	Het
Vac14	T	A	8: 110,715,496	M702K	probably damaging	Het
Vmn1r43	T	C	6: 89,869,903	I200M	probably benign	Het
Vmn2r108	T	A	17: 20,481,076	Y54F	probably benign	Het
Vps13b	T	C	15: 35,640,634	Y1382H	probably damaging	Het
Wdr72	T	C	9: 74,210,472	I834T	probably damaging	Het
Zfp970	T	A	2: 177,475,292	C220S	probably damaging	Het
Zkscan5	T	G	5: 145,220,089	I467S	probably benign	Het

Other mutations in Rpe65

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00922:Rpe65	APN	3	159614542	missense	probably damaging	0.99
IGL01446:Rpe65	APN	3	159600405	splice site	probably benign
IGL01815:Rpe65	APN	3	159604530	splice site	probably null
IGL02085:Rpe65	APN	3	159615646	missense	probably benign	0.00
IGL02232:Rpe65	APN	3	159604351	missense	possibly damaging	0.93
IGL02248:Rpe65	APN	3	159624705	missense	probably damaging	1.00
IGL02645:Rpe65	APN	3	159606491	missense	probably damaging	0.99
IGL02711:Rpe65	APN	3	159622877	missense	possibly damaging	0.84
IGL02982:Rpe65	APN	3	159600361	missense	probably damaging	0.99
IGL03280:Rpe65	APN	3	159604341	missense	probably damaging	0.96
IGL03350:Rpe65	APN	3	159614517	missense	possibly damaging	0.75
IGL03356:Rpe65	APN	3	159615577	missense	possibly damaging	0.89
I1329:Rpe65	UTSW	3	159624723	missense	probably benign	0.35
R0571:Rpe65	UTSW	3	159600349	missense	probably damaging	1.00
R0905:Rpe65	UTSW	3	159601583	missense	possibly damaging	0.95
R1024:Rpe65	UTSW	3	159606485	missense	probably benign	0.07
R1597:Rpe65	UTSW	3	159614784	missense	probably damaging	0.97
R1657:Rpe65	UTSW	3	159614448	missense	probably damaging	0.97
R1778:Rpe65	UTSW	3	159622848	missense	probably damaging	1.00
R1970:Rpe65	UTSW	3	159615670	missense	probably benign
R2259:Rpe65	UTSW	3	159615571	missense	probably damaging	1.00
R3012:Rpe65	UTSW	3	159604563	missense	possibly damaging	0.61
R3923:Rpe65	UTSW	3	159604400	missense	probably benign	0.16
R3975:Rpe65	UTSW	3	159604585	missense	probably damaging	1.00
R4204:Rpe65	UTSW	3	159604410	missense	probably damaging	0.99
R4825:Rpe65	UTSW	3	159624681	missense	probably benign
R4924:Rpe65	UTSW	3	159622631	missense	probably benign	0.01
R5269:Rpe65	UTSW	3	159604347	missense	probably benign	0.07
R5324:Rpe65	UTSW	3	159604404	missense	possibly damaging	0.94
R5441:Rpe65	UTSW	3	159604401	missense	probably damaging	1.00
R5854:Rpe65	UTSW	3	159615676	missense	probably benign
R5907:Rpe65	UTSW	3	159615682	critical splice donor site	probably null
R6149:Rpe65	UTSW	3	159614143	missense	probably benign
R6660:Rpe65	UTSW	3	159614708	missense	probably damaging	0.98
R6830:Rpe65	UTSW	3	159614168	missense	probably benign	0.06
R7025:Rpe65	UTSW	3	159622685	missense	probably damaging	1.00
R7203:Rpe65	UTSW	3	159622854	missense	probably damaging	0.99
R7366:Rpe65	UTSW	3	159624729	missense	probably benign	0.13
R7537:Rpe65	UTSW	3	159604609	missense	probably damaging	0.98
R7679:Rpe65	UTSW	3	159604393	missense	probably damaging	1.00
R8044:Rpe65	UTSW	3	159614705	missense	probably benign
R8179:Rpe65	UTSW	3	159624699	missense	probably benign	0.06
R8409:Rpe65	UTSW	3	159614148	missense	probably benign	0.01
R8558:Rpe65	UTSW	3	159614792	missense	probably damaging	1.00
R9042:Rpe65	UTSW	3	159615655	missense	probably damaging	1.00
R9483:Rpe65	UTSW	3	159622681	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGGGTTGTGACCTAAGGAAC -3'
(R):5'- GGGAATCACTGGGTCTGTAG -3'

Sequencing Primer
(F):5'- CCAACAGTGGTAGAGCACTTGTC -3'
(R):5'- GTGGAAGTCACCCTTTCTAAATCAC -3'

Posted On

2019-05-15