Incidental Mutation 'R7092:Ppme1'
ID550282
Institutional Source Beutler Lab
Gene Symbol Ppme1
Ensembl Gene ENSMUSG00000030718
Gene Nameprotein phosphatase methylesterase 1
Synonyms1110069N17Rik, PME-1, 2700017M01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7092 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location100326737-100372307 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to T at 100371822 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000032963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032963] [ENSMUST00000051777] [ENSMUST00000098259] [ENSMUST00000133464]
Predicted Effect probably null
Transcript: ENSMUST00000032963
AA Change: M1K

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000032963
Gene: ENSMUSG00000030718
AA Change: M1K

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
Pfam:Hydrolase_4 73 199 5.2e-13 PFAM
Pfam:Abhydrolase_1 77 356 7.4e-17 PFAM
Pfam:Abhydrolase_5 78 259 1.3e-14 PFAM
Pfam:Abhydrolase_6 79 362 2.4e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000051777
SMART Domains Protein: ENSMUSP00000062637
Gene: ENSMUSG00000047248

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 406 417 N/A INTRINSIC
C2 524 662 2.36e1 SMART
C2 790 899 3.73e0 SMART
C2 989 1129 1.47e1 SMART
C2 1182 1321 1.63e1 SMART
C2 1617 1724 1.43e-2 SMART
low complexity region 1892 1906 N/A INTRINSIC
low complexity region 2037 2049 N/A INTRINSIC
low complexity region 2110 2125 N/A INTRINSIC
low complexity region 2180 2197 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098259
SMART Domains Protein: ENSMUSP00000095859
Gene: ENSMUSG00000047248

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 406 417 N/A INTRINSIC
C2 524 662 2.36e1 SMART
C2 790 899 3.73e0 SMART
C2 989 1129 1.47e1 SMART
C2 1182 1321 1.63e1 SMART
C2 1617 1724 1.43e-2 SMART
low complexity region 1892 1906 N/A INTRINSIC
low complexity region 2037 2049 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133464
SMART Domains Protein: ENSMUSP00000118864
Gene: ENSMUSG00000047248

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (88/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein phosphatase methylesterase localized to the nucleus. The encoded protein acts on the protein phosphatase-2A catalytic subunit and supports the ERK pathway through dephosphorylation of regulatory proteins. It plays a role in malignant glioma progression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2012]
PHENOTYPE: Targeted disruption of this gene causes virtual loss of the demethylated form of phosphoprotein phosphatase 2A in the nervous system and peripheral tissues. Homozygous null mice fail to initiate normal breathing or suckling behavior and die within the first day of life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik G A 9: 103,281,043 S106L possibly damaging Het
1700034I23Rik T A 3: 40,902,374 D22V possibly damaging Het
4922502D21Rik T A 6: 129,323,000 T172S probably benign Het
4930579F01Rik C T 3: 138,183,745 C37Y probably benign Het
8430408G22Rik C A 6: 116,651,788 P31T probably damaging Het
A430005L14Rik T A 4: 153,960,994 probably null Het
Abca4 C G 3: 122,138,569 P1499A probably damaging Het
Adcy8 T C 15: 64,871,770 N330D possibly damaging Het
Arfgef1 A G 1: 10,153,676 Y1466H probably damaging Het
Asz1 A C 6: 18,071,819 probably null Het
Atad5 T A 11: 80,120,720 N1307K possibly damaging Het
B4galnt4 C A 7: 141,068,636 F688L probably damaging Het
Birc6 C T 17: 74,646,745 T3349I probably damaging Het
Ccp110 C A 7: 118,735,271 A989E probably benign Het
Ccser2 A G 14: 36,940,655 S191P probably benign Het
Cdca2 A G 14: 67,707,351 probably null Het
Cdcp1 T A 9: 123,183,613 T290S probably benign Het
Cnnm1 T C 19: 43,441,948 Y502H probably damaging Het
Cyba T G 8: 122,427,698 T29P probably damaging Het
Dcaf12 A T 4: 41,301,366 I190N probably damaging Het
Epha1 T C 6: 42,364,245 T512A probably benign Het
Fancg G A 4: 43,004,831 P454L probably benign Het
Fasn A C 11: 120,820,120 V268G possibly damaging Het
Fgfr1op C T 17: 8,172,970 P161S probably benign Het
Fip1l1 T A 5: 74,536,843 L42Q probably damaging Het
Fjx1 A G 2: 102,450,756 L278P possibly damaging Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
Gm1527 T A 3: 28,914,547 probably null Het
Gm8298 T C 3: 59,861,079 F10S probably benign Het
Gng3 T A 19: 8,838,247 M42L probably benign Het
Gsdmc2 T A 15: 63,825,098 Q408L probably damaging Het
Gtpbp3 T A 8: 71,492,265 I388K probably benign Het
Hmcn1 A T 1: 150,604,246 W4534R probably damaging Het
Ist1 A T 8: 109,682,596 probably null Het
Kif1bp C A 10: 62,578,300 K26N probably damaging Het
Kyat3 T C 3: 142,729,795 I276T probably damaging Het
Lipm C T 19: 34,121,358 P411S possibly damaging Het
Lipo3 T C 19: 33,613,692 probably null Het
Lrrc9 C A 12: 72,463,464 Q446K possibly damaging Het
Mfsd4a G T 1: 132,067,663 T77N probably benign Het
Mmp1b T A 9: 7,386,981 D77V probably damaging Het
Mrgprb4 A G 7: 48,198,236 S315P probably benign Het
Mroh2b C A 15: 4,934,678 N887K possibly damaging Het
Mto1 A G 9: 78,470,673 K599R probably benign Het
Muc5ac T C 7: 141,809,648 probably benign Het
Muc5ac G C 7: 141,809,687 probably benign Het
Mylk2 A G 2: 152,915,190 N295S probably benign Het
Nr1i3 G A 1: 171,214,178 probably null Het
Nup107 T C 10: 117,790,494 K25E probably damaging Het
Odc1 G A 12: 17,548,313 V152I possibly damaging Het
Olfr1022 A T 2: 85,868,607 N5I probably damaging Het
Olfr364-ps1 T A 2: 37,146,611 M133K probably damaging Het
Olfr53 G A 7: 140,652,237 G86D probably benign Het
Olfr828 G A 9: 18,816,057 P79L probably damaging Het
Pde1b G T 15: 103,527,031 V438L probably benign Het
Pde4b G A 4: 102,601,851 V523M probably damaging Het
Pdgfc C T 3: 81,204,352 P205S probably damaging Het
Per2 A G 1: 91,421,431 S1073P probably damaging Het
Plekhg5 C T 4: 152,114,508 T1051I probably damaging Het
Prokr2 A T 2: 132,381,316 V102D possibly damaging Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Ptprh C A 7: 4,580,861 probably null Het
Rbsn T C 6: 92,189,626 N679S probably damaging Het
Rce1 T C 19: 4,623,090 T303A probably damaging Het
Rnf123 C A 9: 108,068,600 R329L probably benign Het
Robo2 T A 16: 73,956,643 N782I probably damaging Het
Ror2 A C 13: 53,110,236 V940G probably benign Het
Rpe65 C T 3: 159,615,591 R347C probably damaging Het
Rrp8 A T 7: 105,734,109 F317I probably damaging Het
Sidt1 A G 16: 44,299,829 V163A possibly damaging Het
Sin3b T C 8: 72,747,870 probably null Het
Slamf1 A G 1: 171,777,189 T176A probably benign Het
Slc12a4 G T 8: 105,945,223 A922D probably damaging Het
Slco1a5 T A 6: 142,248,675 Q414L probably benign Het
Snx11 C A 11: 96,772,839 R58L probably damaging Het
Sp9 A G 2: 73,273,771 D223G probably damaging Het
Sptbn1 T C 11: 30,137,119 I1107V possibly damaging Het
Stap2 T C 17: 56,002,954 R66G probably benign Het
Synrg T G 11: 84,008,857 F552V possibly damaging Het
Trim60 C T 8: 65,001,048 R183H probably benign Het
Ttn T C 2: 76,903,416 D4505G unknown Het
Ubxn4 A G 1: 128,252,222 I34M probably benign Het
Vac14 T A 8: 110,715,496 M702K probably damaging Het
Vmn1r43 T C 6: 89,869,903 I200M probably benign Het
Vmn2r108 T A 17: 20,481,076 Y54F probably benign Het
Vps13b T C 15: 35,640,634 Y1382H probably damaging Het
Wdr72 T C 9: 74,210,472 I834T probably damaging Het
Zfp970 T A 2: 177,475,292 C220S probably damaging Het
Zkscan5 T G 5: 145,220,089 I467S probably benign Het
Other mutations in Ppme1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02138:Ppme1 APN 7 100333932 missense probably damaging 1.00
IGL02957:Ppme1 APN 7 100338440 missense possibly damaging 0.93
R0328:Ppme1 UTSW 7 100333975 splice site probably null
R3015:Ppme1 UTSW 7 100331877 missense probably damaging 1.00
R4042:Ppme1 UTSW 7 100341065 missense probably damaging 1.00
R4090:Ppme1 UTSW 7 100347837 missense possibly damaging 0.85
R4987:Ppme1 UTSW 7 100345071 missense probably benign 0.01
R5579:Ppme1 UTSW 7 100344975 missense probably damaging 1.00
R6035:Ppme1 UTSW 7 100354795 nonsense probably null
R6035:Ppme1 UTSW 7 100354795 nonsense probably null
R6374:Ppme1 UTSW 7 100341065 missense probably damaging 1.00
R6462:Ppme1 UTSW 7 100338392 missense probably benign 0.01
R7468:Ppme1 UTSW 7 100341862 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TTCCCGTGGCACTCTGAATG -3'
(R):5'- CAGTTTCCTTTGTGCGAAGG -3'

Sequencing Primer
(F):5'- TGGCACTCTGAATGCCCAGAC -3'
(R):5'- AAGGCTGTTGCGCACTTC -3'
Posted On2019-05-15