Incidental Mutation 'R0615:Wnt3'
ID55029
Institutional Source Beutler Lab
Gene Symbol Wnt3
Ensembl Gene ENSMUSG00000000125
Gene Namewingless-type MMTV integration site family, member 3
SynonymsInt-4, Wnt-3
MMRRC Submission 038804-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0615 (G1)
Quality Score158
Status Validated
Chromosome11
Chromosomal Location103774150-103817957 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103812381 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 230 (I230T)
Ref Sequence ENSEMBL: ENSMUSP00000000127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000127]
Predicted Effect possibly damaging
Transcript: ENSMUST00000000127
AA Change: I230T

PolyPhen 2 Score 0.684 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000000127
Gene: ENSMUSG00000000125
AA Change: I230T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
WNT1 47 355 1.24e-216 SMART
Meta Mutation Damage Score 0.3562 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It encodes a protein which shows 98% amino acid identity to mouse Wnt3 protein, and 84% to human WNT3A protein, another WNT gene product. The mouse studies show the requirement of Wnt3 in primary axis formation in the mouse. Studies of the gene expression suggest that this gene may play a key role in some cases of human breast, rectal, lung, and gastric cancer through activation of the WNT-beta-catenin-TCF signaling pathway. This gene is clustered with WNT15, another family member, in the chromosome 17q21 region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants develop to the egg cylinder stage, but fail to form a primitive streak, mesoderm, or node, and die by embryonic day 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik C A 11: 29,824,515 R314L probably damaging Het
4933411K16Rik T C 19: 42,052,523 I31T possibly damaging Het
Abca13 A G 11: 9,256,197 I166V probably damaging Het
Acaa2 G T 18: 74,798,446 V238L probably benign Het
Ahsg A T 16: 22,899,055 I296F possibly damaging Het
Aspm T A 1: 139,487,289 V1436D probably damaging Het
Ate1 A T 7: 130,513,833 probably benign Het
Atp1a4 A T 1: 172,232,060 probably benign Het
Aurkc A T 7: 7,002,403 I223L possibly damaging Het
Bckdha G T 7: 25,641,785 D50E probably benign Het
Brf2 C T 8: 27,124,031 E376K probably benign Het
Cdk9 C A 2: 32,709,801 L141F possibly damaging Het
Cgn A C 3: 94,770,714 probably benign Het
Clcn1 G A 6: 42,305,575 V526I probably damaging Het
Cnot2 A G 10: 116,498,236 V343A possibly damaging Het
Commd2 A T 3: 57,646,695 V195D possibly damaging Het
Cubn C T 2: 13,360,252 probably null Het
Eif2ak4 C T 2: 118,436,185 T729M probably damaging Het
Elac1 A T 18: 73,738,883 V347E probably damaging Het
Fam209 T C 2: 172,474,133 S143P probably benign Het
Fam20c G A 5: 138,807,486 R454Q probably damaging Het
Fam214a T A 9: 75,004,288 Y14N probably damaging Het
Faxc C T 4: 21,958,608 S255L probably benign Het
Foxj1 T C 11: 116,334,082 D153G possibly damaging Het
Gm6605 C A 7: 38,448,275 noncoding transcript Het
Lmo7 T A 14: 101,876,859 Y12* probably null Het
Matn3 T G 12: 8,963,594 C425W probably damaging Het
Mmd2 A T 5: 142,564,913 M190K probably benign Het
Morn2 A T 17: 80,295,597 T102S probably damaging Het
Nr3c2 A C 8: 77,185,889 T710P probably benign Het
Nrros C A 16: 32,144,085 L343F probably damaging Het
Ntrk2 C T 13: 59,128,186 Q767* probably null Het
Olfr1297 C T 2: 111,621,919 D52N possibly damaging Het
Olfr92 G C 17: 37,111,455 L176V probably benign Het
Plekhf2 C T 4: 10,991,330 R4H probably benign Het
Ppox A G 1: 171,277,814 probably benign Het
Qprt T A 7: 127,109,076 D61V probably damaging Het
Reln A G 5: 22,010,150 V1101A probably benign Het
Sbno1 T C 5: 124,410,139 N124D probably damaging Het
Scx C T 15: 76,458,095 P165L probably benign Het
Sema6d T C 2: 124,654,135 probably benign Het
Serf2 T C 2: 121,450,855 F92L probably benign Het
Synpo2 A T 3: 123,117,287 N236K probably damaging Het
Tbc1d32 C A 10: 56,224,640 D81Y probably benign Het
Terf2 G A 8: 107,082,990 T232I possibly damaging Het
Tpd52l2 A G 2: 181,501,951 E50G probably damaging Het
Tprn A G 2: 25,264,198 E504G probably damaging Het
Tufm G T 7: 126,487,482 R12L probably benign Het
Vmn2r8 A G 5: 108,799,329 F519S probably damaging Het
Vwa8 T C 14: 78,908,150 V89A probably benign Het
Zan A T 5: 137,468,431 F388Y probably damaging Het
Zfp474 C T 18: 52,638,349 L25F probably benign Het
Other mutations in Wnt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01294:Wnt3 APN 11 103808314 missense possibly damaging 0.81
IGL01645:Wnt3 APN 11 103812378 missense probably benign 0.00
IGL01989:Wnt3 APN 11 103812407 missense probably benign 0.44
IGL02087:Wnt3 APN 11 103812359 missense probably benign 0.34
IGL02525:Wnt3 APN 11 103812470 missense probably damaging 1.00
R0494:Wnt3 UTSW 11 103812315 missense probably damaging 1.00
R1438:Wnt3 UTSW 11 103808251 missense probably damaging 1.00
R2058:Wnt3 UTSW 11 103812285 missense probably damaging 0.97
R2127:Wnt3 UTSW 11 103812648 missense possibly damaging 0.82
R2128:Wnt3 UTSW 11 103812648 missense possibly damaging 0.82
R4470:Wnt3 UTSW 11 103812624 missense probably damaging 0.99
R4878:Wnt3 UTSW 11 103808205 missense possibly damaging 0.88
R5616:Wnt3 UTSW 11 103812770 critical splice donor site probably null
R6052:Wnt3 UTSW 11 103808174 nonsense probably null
R6472:Wnt3 UTSW 11 103808274 missense possibly damaging 0.89
R6687:Wnt3 UTSW 11 103812585 missense probably damaging 1.00
R7652:Wnt3 UTSW 11 103812464 missense possibly damaging 0.83
R7760:Wnt3 UTSW 11 103811440 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTCTCCCGGTGTGTCAGTCTGAAC -3'
(R):5'- AGATGCGAATACACTCTTGGCAGC -3'

Sequencing Primer
(F):5'- AGTCTGAACTAGCTGCTGC -3'
(R):5'- GAAGACGCAATGGCATTTCTC -3'
Posted On2013-07-11