Incidental Mutation 'R7092:Or7g16'
ID 550297
Institutional Source Beutler Lab
Gene Symbol Or7g16
Ensembl Gene ENSMUSG00000078116
Gene Name olfactory receptor family 7 subfamily G member 16
Synonyms GA_x6K02T2PVTD-12559294-12558356, Olfr828, MOR149-1
MMRRC Submission 045186-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.136) question?
Stock # R7092 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 18726650-18727588 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 18727353 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 79 (P79L)
Ref Sequence ENSEMBL: ENSMUSP00000148853 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000104914] [ENSMUST00000215380]
AlphaFold Q8VFM8
Predicted Effect probably damaging
Transcript: ENSMUST00000104914
AA Change: P79L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100514
Gene: ENSMUSG00000078116
AA Change: P79L

DomainStartEndE-ValueType
Pfam:7tm_4 31 310 1e-48 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.4e-5 PFAM
Pfam:7tm_1 41 290 2.1e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215380
AA Change: P79L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (88/89)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik C T 3: 137,889,506 (GRCm39) C37Y probably benign Het
A430005L14Rik T A 4: 154,045,451 (GRCm39) probably null Het
Aadacl2fm3 T C 3: 59,768,500 (GRCm39) F10S probably benign Het
Abca4 C G 3: 121,932,218 (GRCm39) P1499A probably damaging Het
Adcy8 T C 15: 64,743,619 (GRCm39) N330D possibly damaging Het
Arfgef1 A G 1: 10,223,901 (GRCm39) Y1466H probably damaging Het
Asz1 A C 6: 18,071,818 (GRCm39) probably null Het
Atad5 T A 11: 80,011,546 (GRCm39) N1307K possibly damaging Het
B4galnt4 C A 7: 140,648,549 (GRCm39) F688L probably damaging Het
Birc6 C T 17: 74,953,740 (GRCm39) T3349I probably damaging Het
Ccp110 C A 7: 118,334,494 (GRCm39) A989E probably benign Het
Ccser2 A G 14: 36,662,612 (GRCm39) S191P probably benign Het
Cdca2 A G 14: 67,944,800 (GRCm39) probably null Het
Cdcp1 T A 9: 123,012,678 (GRCm39) T290S probably benign Het
Cep43 C T 17: 8,391,802 (GRCm39) P161S probably benign Het
Clec2m T A 6: 129,299,963 (GRCm39) T172S probably benign Het
Cnnm1 T C 19: 43,430,387 (GRCm39) Y502H probably damaging Het
Cyba T G 8: 123,154,437 (GRCm39) T29P probably damaging Het
Dcaf12 A T 4: 41,301,366 (GRCm39) I190N probably damaging Het
Depp1 C A 6: 116,628,749 (GRCm39) P31T probably damaging Het
Epha1 T C 6: 42,341,179 (GRCm39) T512A probably benign Het
Fancg G A 4: 43,004,831 (GRCm39) P454L probably benign Het
Fasn A C 11: 120,710,946 (GRCm39) V268G possibly damaging Het
Fip1l1 T A 5: 74,697,504 (GRCm39) L42Q probably damaging Het
Fjx1 A G 2: 102,281,101 (GRCm39) L278P possibly damaging Het
Fsd1 G A 17: 56,300,876 (GRCm39) R245H probably damaging Het
Fundc2b T A 3: 40,856,809 (GRCm39) D22V possibly damaging Het
Gm1527 T A 3: 28,968,696 (GRCm39) probably null Het
Gng3 T A 19: 8,815,611 (GRCm39) M42L probably benign Het
Gsdmc2 T A 15: 63,696,947 (GRCm39) Q408L probably damaging Het
Gtpbp3 T A 8: 71,944,909 (GRCm39) I388K probably benign Het
Hmcn1 A T 1: 150,479,997 (GRCm39) W4534R probably damaging Het
Inhca G A 9: 103,158,242 (GRCm39) S106L possibly damaging Het
Ist1 A T 8: 110,409,228 (GRCm39) probably null Het
Kifbp C A 10: 62,414,079 (GRCm39) K26N probably damaging Het
Kyat3 T C 3: 142,435,556 (GRCm39) I276T probably damaging Het
Lipm C T 19: 34,098,758 (GRCm39) P411S possibly damaging Het
Lipo3 T C 19: 33,591,092 (GRCm39) probably null Het
Lrrc9 C A 12: 72,510,238 (GRCm39) Q446K possibly damaging Het
Mfsd4a G T 1: 131,995,401 (GRCm39) T77N probably benign Het
Mmp1b T A 9: 7,386,981 (GRCm39) D77V probably damaging Het
Mrgprb4 A G 7: 47,847,984 (GRCm39) S315P probably benign Het
Mroh2b C A 15: 4,964,160 (GRCm39) N887K possibly damaging Het
Mto1 A G 9: 78,377,955 (GRCm39) K599R probably benign Het
Muc5ac G C 7: 141,363,424 (GRCm39) probably benign Het
Muc5ac T C 7: 141,363,385 (GRCm39) probably benign Het
Mylk2 A G 2: 152,757,110 (GRCm39) N295S probably benign Het
Nr1i3 G A 1: 171,041,747 (GRCm39) probably null Het
Nup107 T C 10: 117,626,399 (GRCm39) K25E probably damaging Het
Odc1 G A 12: 17,598,314 (GRCm39) V152I possibly damaging Het
Or13a20 G A 7: 140,232,150 (GRCm39) G86D probably benign Het
Or1l4b T A 2: 37,036,623 (GRCm39) M133K probably damaging Het
Or5m10b A T 2: 85,698,951 (GRCm39) N5I probably damaging Het
Pde1b G T 15: 103,435,458 (GRCm39) V438L probably benign Het
Pde4b G A 4: 102,459,048 (GRCm39) V523M probably damaging Het
Pdgfc C T 3: 81,111,659 (GRCm39) P205S probably damaging Het
Per2 A G 1: 91,349,153 (GRCm39) S1073P probably damaging Het
Plekhg5 C T 4: 152,198,965 (GRCm39) T1051I probably damaging Het
Ppme1 A T 7: 100,021,029 (GRCm39) M1K probably null Het
Prokr2 A T 2: 132,223,236 (GRCm39) V102D possibly damaging Het
Ptk2 G A 15: 73,093,658 (GRCm39) P854S possibly damaging Het
Ptprh C A 7: 4,583,860 (GRCm39) probably null Het
Rbsn T C 6: 92,166,607 (GRCm39) N679S probably damaging Het
Rce1 T C 19: 4,673,118 (GRCm39) T303A probably damaging Het
Rnf123 C A 9: 107,945,799 (GRCm39) R329L probably benign Het
Robo2 T A 16: 73,753,531 (GRCm39) N782I probably damaging Het
Ror2 A C 13: 53,264,272 (GRCm39) V940G probably benign Het
Rpe65 C T 3: 159,321,228 (GRCm39) R347C probably damaging Het
Rrp8 A T 7: 105,383,316 (GRCm39) F317I probably damaging Het
Sidt1 A G 16: 44,120,192 (GRCm39) V163A possibly damaging Het
Sin3b T C 8: 73,474,498 (GRCm39) probably null Het
Slamf1 A G 1: 171,604,757 (GRCm39) T176A probably benign Het
Slc12a4 G T 8: 106,671,855 (GRCm39) A922D probably damaging Het
Slco1a5 T A 6: 142,194,401 (GRCm39) Q414L probably benign Het
Snx11 C A 11: 96,663,665 (GRCm39) R58L probably damaging Het
Sp9 A G 2: 73,104,115 (GRCm39) D223G probably damaging Het
Sptbn1 T C 11: 30,087,119 (GRCm39) I1107V possibly damaging Het
Stap2 T C 17: 56,309,954 (GRCm39) R66G probably benign Het
Synrg T G 11: 83,899,683 (GRCm39) F552V possibly damaging Het
Trim60 C T 8: 65,453,700 (GRCm39) R183H probably benign Het
Ttn T C 2: 76,733,760 (GRCm39) D4505G unknown Het
Ubxn4 A G 1: 128,179,959 (GRCm39) I34M probably benign Het
Vac14 T A 8: 111,442,128 (GRCm39) M702K probably damaging Het
Vmn1r43 T C 6: 89,846,885 (GRCm39) I200M probably benign Het
Vmn2r108 T A 17: 20,701,338 (GRCm39) Y54F probably benign Het
Vps13b T C 15: 35,640,780 (GRCm39) Y1382H probably damaging Het
Wdr72 T C 9: 74,117,754 (GRCm39) I834T probably damaging Het
Zfp970 T A 2: 177,167,085 (GRCm39) C220S probably damaging Het
Zkscan5 T G 5: 145,156,899 (GRCm39) I467S probably benign Het
Other mutations in Or7g16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02088:Or7g16 APN 9 18,727,219 (GRCm39) missense probably benign 0.03
IGL02103:Or7g16 APN 9 18,727,005 (GRCm39) missense probably damaging 1.00
IGL02792:Or7g16 APN 9 18,727,254 (GRCm39) missense probably benign 0.00
IGL02964:Or7g16 APN 9 18,727,024 (GRCm39) missense probably damaging 1.00
IGL03087:Or7g16 APN 9 18,727,380 (GRCm39) missense probably damaging 1.00
IGL03105:Or7g16 APN 9 18,726,685 (GRCm39) missense probably benign 0.03
R0330:Or7g16 UTSW 9 18,726,937 (GRCm39) missense probably damaging 1.00
R0335:Or7g16 UTSW 9 18,727,290 (GRCm39) missense probably damaging 1.00
R0862:Or7g16 UTSW 9 18,727,002 (GRCm39) missense probably damaging 0.98
R1226:Or7g16 UTSW 9 18,727,266 (GRCm39) missense probably benign 0.34
R2004:Or7g16 UTSW 9 18,726,801 (GRCm39) missense probably benign 0.05
R2005:Or7g16 UTSW 9 18,726,801 (GRCm39) missense probably benign 0.05
R2006:Or7g16 UTSW 9 18,726,801 (GRCm39) missense probably benign 0.05
R2199:Or7g16 UTSW 9 18,727,219 (GRCm39) missense probably damaging 0.97
R2230:Or7g16 UTSW 9 18,727,021 (GRCm39) missense probably damaging 1.00
R2399:Or7g16 UTSW 9 18,727,323 (GRCm39) missense probably benign 0.07
R5652:Or7g16 UTSW 9 18,726,922 (GRCm39) missense probably damaging 1.00
R5738:Or7g16 UTSW 9 18,727,125 (GRCm39) missense possibly damaging 0.81
R6416:Or7g16 UTSW 9 18,727,188 (GRCm39) missense probably benign 0.21
R6813:Or7g16 UTSW 9 18,727,188 (GRCm39) missense probably benign 0.21
R7109:Or7g16 UTSW 9 18,726,904 (GRCm39) missense probably benign 0.01
R7292:Or7g16 UTSW 9 18,727,486 (GRCm39) missense probably damaging 1.00
R7429:Or7g16 UTSW 9 18,726,650 (GRCm39) makesense probably null
R7430:Or7g16 UTSW 9 18,726,650 (GRCm39) makesense probably null
R7490:Or7g16 UTSW 9 18,727,229 (GRCm39) nonsense probably null
R7835:Or7g16 UTSW 9 18,727,105 (GRCm39) missense probably benign 0.05
R8016:Or7g16 UTSW 9 18,727,588 (GRCm39) start codon destroyed probably null 0.56
R8809:Or7g16 UTSW 9 18,726,919 (GRCm39) missense probably damaging 0.99
R8859:Or7g16 UTSW 9 18,726,992 (GRCm39) missense possibly damaging 0.90
R9036:Or7g16 UTSW 9 18,727,569 (GRCm39) missense probably damaging 1.00
R9079:Or7g16 UTSW 9 18,726,731 (GRCm39) missense probably damaging 0.99
R9177:Or7g16 UTSW 9 18,726,742 (GRCm39) missense probably damaging 1.00
R9182:Or7g16 UTSW 9 18,726,742 (GRCm39) missense probably damaging 1.00
R9184:Or7g16 UTSW 9 18,727,138 (GRCm39) missense probably benign 0.10
RF003:Or7g16 UTSW 9 18,726,778 (GRCm39) missense probably benign 0.03
X0026:Or7g16 UTSW 9 18,727,059 (GRCm39) missense possibly damaging 0.95
Z1176:Or7g16 UTSW 9 18,727,276 (GRCm39) frame shift probably null
Z1177:Or7g16 UTSW 9 18,727,444 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GGGTGTCAGAACAAGCTAGC -3'
(R):5'- TGAAGCCCCTCATCTTCAGC -3'

Sequencing Primer
(F):5'- GACCACAGGTTTGAGGATTCATGATC -3'
(R):5'- AGCATGTTCACCTCCATGTAC -3'
Posted On 2019-05-15