Incidental Mutation 'R7092:Rnf123'
ID 550301
Institutional Source Beutler Lab
Gene Symbol Rnf123
Ensembl Gene ENSMUSG00000041528
Gene Name ring finger protein 123
Synonyms KPC1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.222) question?
Stock # R7092 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 108051534-108083346 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 108068600 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 329 (R329L)
Ref Sequence ENSEMBL: ENSMUSP00000125745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047746] [ENSMUST00000160249] [ENSMUST00000160649] [ENSMUST00000161828] [ENSMUST00000162355] [ENSMUST00000162516] [ENSMUST00000174504] [ENSMUST00000178267]
AlphaFold Q5XPI3
Predicted Effect probably benign
Transcript: ENSMUST00000047746
AA Change: R329L

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000040803
Gene: ENSMUSG00000041528
AA Change: R329L

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160249
AA Change: R329L

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528
AA Change: R329L

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160649
AA Change: R329L

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528
AA Change: R329L

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161828
Predicted Effect probably benign
Transcript: ENSMUST00000162355
AA Change: R329L

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000125745
Gene: ENSMUSG00000041528
AA Change: R329L

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162516
Predicted Effect probably benign
Transcript: ENSMUST00000174504
Predicted Effect probably benign
Transcript: ENSMUST00000178267
AA Change: R329L

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528
AA Change: R329L

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (88/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a C-terminal RING finger domain, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions, and an N-terminal SPRY domain. This protein displays E3 ubiquitin ligase activity toward the cyclin-dependent kinase inhibitor 1B which is also known as p27 or KIP1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik G A 9: 103,281,043 S106L possibly damaging Het
1700034I23Rik T A 3: 40,902,374 D22V possibly damaging Het
4922502D21Rik T A 6: 129,323,000 T172S probably benign Het
4930579F01Rik C T 3: 138,183,745 C37Y probably benign Het
8430408G22Rik C A 6: 116,651,788 P31T probably damaging Het
A430005L14Rik T A 4: 153,960,994 probably null Het
Abca4 C G 3: 122,138,569 P1499A probably damaging Het
Adcy8 T C 15: 64,871,770 N330D possibly damaging Het
Arfgef1 A G 1: 10,153,676 Y1466H probably damaging Het
Asz1 A C 6: 18,071,819 probably null Het
Atad5 T A 11: 80,120,720 N1307K possibly damaging Het
B4galnt4 C A 7: 141,068,636 F688L probably damaging Het
Birc6 C T 17: 74,646,745 T3349I probably damaging Het
Ccp110 C A 7: 118,735,271 A989E probably benign Het
Ccser2 A G 14: 36,940,655 S191P probably benign Het
Cdca2 A G 14: 67,707,351 probably null Het
Cdcp1 T A 9: 123,183,613 T290S probably benign Het
Cnnm1 T C 19: 43,441,948 Y502H probably damaging Het
Cyba T G 8: 122,427,698 T29P probably damaging Het
Dcaf12 A T 4: 41,301,366 I190N probably damaging Het
Epha1 T C 6: 42,364,245 T512A probably benign Het
Fancg G A 4: 43,004,831 P454L probably benign Het
Fasn A C 11: 120,820,120 V268G possibly damaging Het
Fgfr1op C T 17: 8,172,970 P161S probably benign Het
Fip1l1 T A 5: 74,536,843 L42Q probably damaging Het
Fjx1 A G 2: 102,450,756 L278P possibly damaging Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
Gm1527 T A 3: 28,914,547 probably null Het
Gm8298 T C 3: 59,861,079 F10S probably benign Het
Gng3 T A 19: 8,838,247 M42L probably benign Het
Gsdmc2 T A 15: 63,825,098 Q408L probably damaging Het
Gtpbp3 T A 8: 71,492,265 I388K probably benign Het
Hmcn1 A T 1: 150,604,246 W4534R probably damaging Het
Ist1 A T 8: 109,682,596 probably null Het
Kif1bp C A 10: 62,578,300 K26N probably damaging Het
Kyat3 T C 3: 142,729,795 I276T probably damaging Het
Lipm C T 19: 34,121,358 P411S possibly damaging Het
Lipo3 T C 19: 33,613,692 probably null Het
Lrrc9 C A 12: 72,463,464 Q446K possibly damaging Het
Mfsd4a G T 1: 132,067,663 T77N probably benign Het
Mmp1b T A 9: 7,386,981 D77V probably damaging Het
Mrgprb4 A G 7: 48,198,236 S315P probably benign Het
Mroh2b C A 15: 4,934,678 N887K possibly damaging Het
Mto1 A G 9: 78,470,673 K599R probably benign Het
Muc5ac T C 7: 141,809,648 probably benign Het
Muc5ac G C 7: 141,809,687 probably benign Het
Mylk2 A G 2: 152,915,190 N295S probably benign Het
Nr1i3 G A 1: 171,214,178 probably null Het
Nup107 T C 10: 117,790,494 K25E probably damaging Het
Odc1 G A 12: 17,548,313 V152I possibly damaging Het
Olfr1022 A T 2: 85,868,607 N5I probably damaging Het
Olfr364-ps1 T A 2: 37,146,611 M133K probably damaging Het
Olfr53 G A 7: 140,652,237 G86D probably benign Het
Olfr828 G A 9: 18,816,057 P79L probably damaging Het
Pde1b G T 15: 103,527,031 V438L probably benign Het
Pde4b G A 4: 102,601,851 V523M probably damaging Het
Pdgfc C T 3: 81,204,352 P205S probably damaging Het
Per2 A G 1: 91,421,431 S1073P probably damaging Het
Plekhg5 C T 4: 152,114,508 T1051I probably damaging Het
Ppme1 A T 7: 100,371,822 M1K probably null Het
Prokr2 A T 2: 132,381,316 V102D possibly damaging Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Ptprh C A 7: 4,580,861 probably null Het
Rbsn T C 6: 92,189,626 N679S probably damaging Het
Rce1 T C 19: 4,623,090 T303A probably damaging Het
Robo2 T A 16: 73,956,643 N782I probably damaging Het
Ror2 A C 13: 53,110,236 V940G probably benign Het
Rpe65 C T 3: 159,615,591 R347C probably damaging Het
Rrp8 A T 7: 105,734,109 F317I probably damaging Het
Sidt1 A G 16: 44,299,829 V163A possibly damaging Het
Sin3b T C 8: 72,747,870 probably null Het
Slamf1 A G 1: 171,777,189 T176A probably benign Het
Slc12a4 G T 8: 105,945,223 A922D probably damaging Het
Slco1a5 T A 6: 142,248,675 Q414L probably benign Het
Snx11 C A 11: 96,772,839 R58L probably damaging Het
Sp9 A G 2: 73,273,771 D223G probably damaging Het
Sptbn1 T C 11: 30,137,119 I1107V possibly damaging Het
Stap2 T C 17: 56,002,954 R66G probably benign Het
Synrg T G 11: 84,008,857 F552V possibly damaging Het
Trim60 C T 8: 65,001,048 R183H probably benign Het
Ttn T C 2: 76,903,416 D4505G unknown Het
Ubxn4 A G 1: 128,252,222 I34M probably benign Het
Vac14 T A 8: 110,715,496 M702K probably damaging Het
Vmn1r43 T C 6: 89,869,903 I200M probably benign Het
Vmn2r108 T A 17: 20,481,076 Y54F probably benign Het
Vps13b T C 15: 35,640,634 Y1382H probably damaging Het
Wdr72 T C 9: 74,210,472 I834T probably damaging Het
Zfp970 T A 2: 177,475,292 C220S probably damaging Het
Zkscan5 T G 5: 145,220,089 I467S probably benign Het
Other mutations in Rnf123
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Rnf123 APN 9 108067395 critical splice donor site probably null
IGL01358:Rnf123 APN 9 108069182 missense probably damaging 1.00
IGL01464:Rnf123 APN 9 108052302 missense probably damaging 1.00
IGL01637:Rnf123 APN 9 108058238 missense probably damaging 1.00
IGL01669:Rnf123 APN 9 108058356 missense probably damaging 0.98
IGL01905:Rnf123 APN 9 108071370 splice site probably benign
IGL02070:Rnf123 APN 9 108068302 nonsense probably null
IGL02072:Rnf123 APN 9 108068302 nonsense probably null
IGL02073:Rnf123 APN 9 108068302 nonsense probably null
IGL02074:Rnf123 APN 9 108066889 missense probably damaging 1.00
IGL02079:Rnf123 APN 9 108068302 nonsense probably null
IGL02080:Rnf123 APN 9 108068302 nonsense probably null
IGL02231:Rnf123 APN 9 108066399 missense probably benign 0.17
IGL02281:Rnf123 APN 9 108071452 missense probably benign 0.01
IGL02336:Rnf123 APN 9 108061842 missense probably damaging 1.00
IGL02543:Rnf123 APN 9 108066348 missense probably damaging 1.00
IGL02565:Rnf123 APN 9 108052212 critical splice donor site probably null
IGL02571:Rnf123 APN 9 108068302 nonsense probably null
IGL02572:Rnf123 APN 9 108068302 nonsense probably null
IGL02574:Rnf123 APN 9 108068302 nonsense probably null
IGL02586:Rnf123 APN 9 108068302 nonsense probably null
IGL02589:Rnf123 APN 9 108068302 nonsense probably null
IGL02600:Rnf123 APN 9 108068302 nonsense probably null
IGL02601:Rnf123 APN 9 108068302 nonsense probably null
IGL02602:Rnf123 APN 9 108068302 nonsense probably null
IGL02603:Rnf123 APN 9 108068302 nonsense probably null
IGL02609:Rnf123 APN 9 108068302 nonsense probably null
IGL02628:Rnf123 APN 9 108068302 nonsense probably null
IGL02629:Rnf123 APN 9 108068302 nonsense probably null
IGL02629:Rnf123 APN 9 108070789 splice site probably benign
IGL02630:Rnf123 APN 9 108068302 nonsense probably null
IGL02631:Rnf123 APN 9 108068302 nonsense probably null
IGL02632:Rnf123 APN 9 108068302 nonsense probably null
IGL02650:Rnf123 APN 9 108069748 missense probably benign 0.29
IGL02690:Rnf123 APN 9 108068302 nonsense probably null
IGL02691:Rnf123 APN 9 108068302 nonsense probably null
IGL02692:Rnf123 APN 9 108068302 nonsense probably null
IGL02693:Rnf123 APN 9 108068302 nonsense probably null
IGL02713:Rnf123 APN 9 108068302 nonsense probably null
IGL02736:Rnf123 APN 9 108068302 nonsense probably null
IGL02929:Rnf123 APN 9 108069076 missense probably benign
R1175:Rnf123 UTSW 9 108077373 missense probably benign
R1465:Rnf123 UTSW 9 108071466 splice site probably benign
R1502:Rnf123 UTSW 9 108068510 splice site probably null
R1682:Rnf123 UTSW 9 108077398 missense probably benign 0.16
R1817:Rnf123 UTSW 9 108062926 missense probably benign 0.41
R1855:Rnf123 UTSW 9 108061791 missense probably damaging 1.00
R2394:Rnf123 UTSW 9 108063536 missense probably benign 0.00
R2483:Rnf123 UTSW 9 108063521 missense probably benign 0.16
R3896:Rnf123 UTSW 9 108069103 splice site probably benign
R3940:Rnf123 UTSW 9 108064035 splice site probably benign
R4206:Rnf123 UTSW 9 108063963 missense probably benign 0.01
R4641:Rnf123 UTSW 9 108058587 missense probably damaging 1.00
R4714:Rnf123 UTSW 9 108052439 splice site probably null
R4767:Rnf123 UTSW 9 108052089 missense probably damaging 1.00
R4849:Rnf123 UTSW 9 108056091 missense probably damaging 1.00
R4899:Rnf123 UTSW 9 108063680 missense probably damaging 1.00
R5274:Rnf123 UTSW 9 108064003 frame shift probably null
R5275:Rnf123 UTSW 9 108064003 frame shift probably null
R5276:Rnf123 UTSW 9 108064003 frame shift probably null
R5294:Rnf123 UTSW 9 108064003 frame shift probably null
R5295:Rnf123 UTSW 9 108064003 frame shift probably null
R5394:Rnf123 UTSW 9 108070731 missense probably damaging 1.00
R5717:Rnf123 UTSW 9 108067424 missense probably damaging 1.00
R6186:Rnf123 UTSW 9 108069958 missense possibly damaging 0.55
R6449:Rnf123 UTSW 9 108056053 missense probably benign 0.17
R6502:Rnf123 UTSW 9 108068332 missense possibly damaging 0.46
R6944:Rnf123 UTSW 9 108063623 missense probably benign 0.02
R7003:Rnf123 UTSW 9 108063683 critical splice acceptor site probably null
R7088:Rnf123 UTSW 9 108058536 missense probably null 1.00
R7100:Rnf123 UTSW 9 108056639 missense probably damaging 1.00
R7257:Rnf123 UTSW 9 108069029 missense probably damaging 1.00
R7453:Rnf123 UTSW 9 108070408 splice site probably null
R7468:Rnf123 UTSW 9 108069009 missense probably benign 0.00
R7517:Rnf123 UTSW 9 108070274 nonsense probably null
R7577:Rnf123 UTSW 9 108070619 missense probably damaging 1.00
R8296:Rnf123 UTSW 9 108062890 missense probably damaging 1.00
R8322:Rnf123 UTSW 9 108068507 missense probably benign 0.26
R8754:Rnf123 UTSW 9 108071164 missense probably damaging 1.00
R8783:Rnf123 UTSW 9 108069073 missense probably benign
R9052:Rnf123 UTSW 9 108059731 missense probably damaging 1.00
R9156:Rnf123 UTSW 9 108063028 splice site probably benign
R9170:Rnf123 UTSW 9 108071176 missense probably damaging 1.00
R9332:Rnf123 UTSW 9 108067505 missense probably benign 0.00
R9385:Rnf123 UTSW 9 108052268 missense probably benign 0.02
R9394:Rnf123 UTSW 9 108065706 missense probably damaging 1.00
R9432:Rnf123 UTSW 9 108059809 missense probably damaging 0.96
R9717:Rnf123 UTSW 9 108077764 missense probably benign 0.43
Z1176:Rnf123 UTSW 9 108058395 missense probably damaging 1.00
Z1176:Rnf123 UTSW 9 108062981 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGAAGTCCAACAGCCTGGC -3'
(R):5'- TGTGATGTCCCAGGCTAAGG -3'

Sequencing Primer
(F):5'- GCCTAAGCCTGGAGTCAGAAATC -3'
(R):5'- CAGGGCCATGAATAGAGCCC -3'
Posted On 2019-05-15