Mutagenetix > Incidental Mutations

Incidental Mutation 'R7092:Sptbn1'

550305

Institutional Source

Beutler Lab

Gene Symbol

Sptbn1

Ensembl Gene

ENSMUSG00000020315

Gene Name

spectrin beta, non-erythrocytic 1

Synonyms

non-erythrocytic, Spnb-2, elf3, 9930031C03Rik, elf1, beta fodrin, brain spectrin, spectrin G, Spnb2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7092 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

30099395-30268175 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 30137119 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 1107 (I1107V)

Ref Sequence

ENSEMBL: ENSMUSP00000011877 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006629] [ENSMUST00000011877] [ENSMUST00000102838] [ENSMUST00000124231]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000006629
AA Change: I1107V

PolyPhen 2 Score 0.746 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000006629
Gene: ENSMUSG00000020315
AA Change: I1107V

Domain	Start	End	E-Value	Type
low complexity region	20	34	N/A	INTRINSIC
CH	56	156	3.02e-28	SMART
CH	175	273	8.73e-25	SMART
SPEC	305	411	2.03e0	SMART
SPEC	425	525	6.42e-26	SMART
SPEC	531	635	4.61e-27	SMART
SPEC	641	741	2.36e-33	SMART
SPEC	747	846	1.2e-25	SMART
SPEC	852	952	7.16e-24	SMART
SPEC	958	1059	6.58e-23	SMART
SPEC	1065	1166	1.79e-24	SMART
SPEC	1172	1272	2.2e-24	SMART
SPEC	1278	1377	5.18e-21	SMART
SPEC	1383	1482	1.02e-19	SMART
SPEC	1488	1589	7.2e-29	SMART
SPEC	1595	1695	8.03e-27	SMART
SPEC	1701	1802	9.73e-26	SMART
SPEC	1808	1908	9.82e-22	SMART
SPEC	1914	2014	8.68e-23	SMART
SPEC	2020	2162	3.1e-10	SMART
PH	2197	2308	1.64e-18	SMART
low complexity region	2312	2327	N/A	INTRINSIC
low complexity region	2343	2355	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000011877
AA Change: I1107V

PolyPhen 2 Score 0.746 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000011877
Gene: ENSMUSG00000020315
AA Change: I1107V

Domain	Start	End	E-Value	Type
low complexity region	20	34	N/A	INTRINSIC
CH	56	156	3.02e-28	SMART
CH	175	273	8.73e-25	SMART
SPEC	305	411	2.03e0	SMART
SPEC	425	525	6.42e-26	SMART
SPEC	531	635	4.61e-27	SMART
SPEC	641	741	2.36e-33	SMART
SPEC	747	846	1.2e-25	SMART
SPEC	852	952	7.16e-24	SMART
SPEC	958	1059	6.58e-23	SMART
SPEC	1065	1166	1.79e-24	SMART
SPEC	1172	1272	2.2e-24	SMART
SPEC	1278	1377	5.18e-21	SMART
SPEC	1383	1482	1.02e-19	SMART
SPEC	1488	1589	7.2e-29	SMART
SPEC	1595	1695	8.03e-27	SMART
SPEC	1701	1802	9.73e-26	SMART
SPEC	1808	1908	9.82e-22	SMART
SPEC	1914	2014	8.68e-23	SMART
SPEC	2020	2162	3.1e-10	SMART
PH	2197	2308	1.64e-18	SMART
low complexity region	2312	2327	N/A	INTRINSIC
low complexity region	2343	2355	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000102838
AA Change: I1094V

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000099902
Gene: ENSMUSG00000020315
AA Change: I1094V

Domain	Start	End	E-Value	Type
CH	43	143	3.02e-28	SMART
CH	162	260	8.73e-25	SMART
SPEC	292	398	2.03e0	SMART
SPEC	412	512	6.42e-26	SMART
SPEC	518	622	4.61e-27	SMART
SPEC	628	728	2.36e-33	SMART
SPEC	734	833	1.2e-25	SMART
SPEC	839	939	7.16e-24	SMART
SPEC	945	1046	6.58e-23	SMART
SPEC	1052	1153	1.79e-24	SMART
SPEC	1159	1259	2.2e-24	SMART
SPEC	1265	1364	5.18e-21	SMART
SPEC	1370	1469	1.02e-19	SMART
SPEC	1475	1576	7.2e-29	SMART
SPEC	1582	1682	8.03e-27	SMART
SPEC	1688	1789	9.73e-26	SMART
SPEC	1795	1895	9.82e-22	SMART
SPEC	1901	2001	8.68e-23	SMART
SPEC	2007	2114	2.66e-9	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000124231
AA Change: I1107V

PolyPhen 2 Score 0.746 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000114841
Gene: ENSMUSG00000020315
AA Change: I1107V

Domain	Start	End	E-Value	Type
low complexity region	20	34	N/A	INTRINSIC
CH	56	156	3.02e-28	SMART
CH	175	273	8.73e-25	SMART
SPEC	305	411	2.03e0	SMART
SPEC	425	525	6.42e-26	SMART
SPEC	531	635	4.61e-27	SMART
SPEC	641	741	2.36e-33	SMART
SPEC	747	846	1.2e-25	SMART
SPEC	852	952	7.16e-24	SMART
SPEC	958	1059	6.58e-23	SMART
SPEC	1065	1166	1.79e-24	SMART
SPEC	1172	1272	2.2e-24	SMART
SPEC	1278	1377	5.18e-21	SMART
SPEC	1383	1482	1.02e-19	SMART
SPEC	1488	1589	7.2e-29	SMART
SPEC	1595	1695	8.03e-27	SMART
SPEC	1701	1802	9.73e-26	SMART
SPEC	1808	1908	9.82e-22	SMART
SPEC	1914	2014	8.68e-23	SMART
SPEC	2020	2092	6.42e-2	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

99% (88/89)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is composed of two antiparallel dimers of alpha- and beta- subunits. This gene is one member of a family of beta-spectrin genes. The encoded protein contains an N-terminal actin-binding domain, and 17 spectrin repeats which are involved in dimer formation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to mid-gestational lethality due to gastrointestinal, liver, neural, and cardiac defects, whereas heterozygotes survive until adulthood and spontaneously develop cancers in several organs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1300017J02Rik	G	A	9: 103,281,043	S106L	possibly damaging	Het
1700034I23Rik	T	A	3: 40,902,374	D22V	possibly damaging	Het
4922502D21Rik	T	A	6: 129,323,000	T172S	probably benign	Het
4930579F01Rik	C	T	3: 138,183,745	C37Y	probably benign	Het
8430408G22Rik	C	A	6: 116,651,788	P31T	probably damaging	Het
A430005L14Rik	T	A	4: 153,960,994		probably null	Het
Abca4	C	G	3: 122,138,569	P1499A	probably damaging	Het
Adcy8	T	C	15: 64,871,770	N330D	possibly damaging	Het
Arfgef1	A	G	1: 10,153,676	Y1466H	probably damaging	Het
Asz1	A	C	6: 18,071,819		probably null	Het
Atad5	T	A	11: 80,120,720	N1307K	possibly damaging	Het
B4galnt4	C	A	7: 141,068,636	F688L	probably damaging	Het
Birc6	C	T	17: 74,646,745	T3349I	probably damaging	Het
Ccp110	C	A	7: 118,735,271	A989E	probably benign	Het
Ccser2	A	G	14: 36,940,655	S191P	probably benign	Het
Cdca2	A	G	14: 67,707,351		probably null	Het
Cdcp1	T	A	9: 123,183,613	T290S	probably benign	Het
Cnnm1	T	C	19: 43,441,948	Y502H	probably damaging	Het
Cyba	T	G	8: 122,427,698	T29P	probably damaging	Het
Dcaf12	A	T	4: 41,301,366	I190N	probably damaging	Het
Epha1	T	C	6: 42,364,245	T512A	probably benign	Het
Fancg	G	A	4: 43,004,831	P454L	probably benign	Het
Fasn	A	C	11: 120,820,120	V268G	possibly damaging	Het
Fgfr1op	C	T	17: 8,172,970	P161S	probably benign	Het
Fip1l1	T	A	5: 74,536,843	L42Q	probably damaging	Het
Fjx1	A	G	2: 102,450,756	L278P	possibly damaging	Het
Fsd1	G	A	17: 55,993,876	R245H	probably damaging	Het
Gm1527	T	A	3: 28,914,547		probably null	Het
Gm8298	T	C	3: 59,861,079	F10S	probably benign	Het
Gng3	T	A	19: 8,838,247	M42L	probably benign	Het
Gsdmc2	T	A	15: 63,825,098	Q408L	probably damaging	Het
Gtpbp3	T	A	8: 71,492,265	I388K	probably benign	Het
Hmcn1	A	T	1: 150,604,246	W4534R	probably damaging	Het
Ist1	A	T	8: 109,682,596		probably null	Het
Kif1bp	C	A	10: 62,578,300	K26N	probably damaging	Het
Kyat3	T	C	3: 142,729,795	I276T	probably damaging	Het
Lipm	C	T	19: 34,121,358	P411S	possibly damaging	Het
Lipo3	T	C	19: 33,613,692		probably null	Het
Lrrc9	C	A	12: 72,463,464	Q446K	possibly damaging	Het
Mfsd4a	G	T	1: 132,067,663	T77N	probably benign	Het
Mmp1b	T	A	9: 7,386,981	D77V	probably damaging	Het
Mrgprb4	A	G	7: 48,198,236	S315P	probably benign	Het
Mroh2b	C	A	15: 4,934,678	N887K	possibly damaging	Het
Mto1	A	G	9: 78,470,673	K599R	probably benign	Het
Muc5ac	T	C	7: 141,809,648		probably benign	Het
Muc5ac	G	C	7: 141,809,687		probably benign	Het
Mylk2	A	G	2: 152,915,190	N295S	probably benign	Het
Nr1i3	G	A	1: 171,214,178		probably null	Het
Nup107	T	C	10: 117,790,494	K25E	probably damaging	Het
Odc1	G	A	12: 17,548,313	V152I	possibly damaging	Het
Olfr1022	A	T	2: 85,868,607	N5I	probably damaging	Het
Olfr364-ps1	T	A	2: 37,146,611	M133K	probably damaging	Het
Olfr53	G	A	7: 140,652,237	G86D	probably benign	Het
Olfr828	G	A	9: 18,816,057	P79L	probably damaging	Het
Pde1b	G	T	15: 103,527,031	V438L	probably benign	Het
Pde4b	G	A	4: 102,601,851	V523M	probably damaging	Het
Pdgfc	C	T	3: 81,204,352	P205S	probably damaging	Het
Per2	A	G	1: 91,421,431	S1073P	probably damaging	Het
Plekhg5	C	T	4: 152,114,508	T1051I	probably damaging	Het
Ppme1	A	T	7: 100,371,822	M1K	probably null	Het
Prokr2	A	T	2: 132,381,316	V102D	possibly damaging	Het
Ptk2	G	A	15: 73,221,809	P854S	possibly damaging	Het
Ptprh	C	A	7: 4,580,861		probably null	Het
Rbsn	T	C	6: 92,189,626	N679S	probably damaging	Het
Rce1	T	C	19: 4,623,090	T303A	probably damaging	Het
Rnf123	C	A	9: 108,068,600	R329L	probably benign	Het
Robo2	T	A	16: 73,956,643	N782I	probably damaging	Het
Ror2	A	C	13: 53,110,236	V940G	probably benign	Het
Rpe65	C	T	3: 159,615,591	R347C	probably damaging	Het
Rrp8	A	T	7: 105,734,109	F317I	probably damaging	Het
Sidt1	A	G	16: 44,299,829	V163A	possibly damaging	Het
Sin3b	T	C	8: 72,747,870		probably null	Het
Slamf1	A	G	1: 171,777,189	T176A	probably benign	Het
Slc12a4	G	T	8: 105,945,223	A922D	probably damaging	Het
Slco1a5	T	A	6: 142,248,675	Q414L	probably benign	Het
Snx11	C	A	11: 96,772,839	R58L	probably damaging	Het
Sp9	A	G	2: 73,273,771	D223G	probably damaging	Het
Stap2	T	C	17: 56,002,954	R66G	probably benign	Het
Synrg	T	G	11: 84,008,857	F552V	possibly damaging	Het
Trim60	C	T	8: 65,001,048	R183H	probably benign	Het
Ttn	T	C	2: 76,903,416	D4505G	unknown	Het
Ubxn4	A	G	1: 128,252,222	I34M	probably benign	Het
Vac14	T	A	8: 110,715,496	M702K	probably damaging	Het
Vmn1r43	T	C	6: 89,869,903	I200M	probably benign	Het
Vmn2r108	T	A	17: 20,481,076	Y54F	probably benign	Het
Vps13b	T	C	15: 35,640,634	Y1382H	probably damaging	Het
Wdr72	T	C	9: 74,210,472	I834T	probably damaging	Het
Zfp970	T	A	2: 177,475,292	C220S	probably damaging	Het
Zkscan5	T	G	5: 145,220,089	I467S	probably benign	Het

Other mutations in Sptbn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00227:Sptbn1	APN	11	30110818	nonsense	probably null
IGL01098:Sptbn1	APN	11	30159385	missense	probably damaging	1.00
IGL01843:Sptbn1	APN	11	30104623	missense	probably benign	0.02
IGL02070:Sptbn1	APN	11	30145979	missense	probably damaging	0.99
IGL02075:Sptbn1	APN	11	30138496	missense	probably damaging	1.00
IGL02094:Sptbn1	APN	11	30100659	missense	probably benign	0.01
IGL02102:Sptbn1	APN	11	30137427	missense	probably damaging	1.00
IGL02189:Sptbn1	APN	11	30117871	missense	probably damaging	1.00
IGL02256:Sptbn1	APN	11	30120990	missense	probably benign	0.24
IGL02301:Sptbn1	APN	11	30142129	missense	probably damaging	1.00
IGL02354:Sptbn1	APN	11	30110783	missense	probably damaging	1.00
IGL02361:Sptbn1	APN	11	30110783	missense	probably damaging	1.00
IGL02377:Sptbn1	APN	11	30119491	missense	possibly damaging	0.92
IGL02504:Sptbn1	APN	11	30142293	missense	probably damaging	1.00
IGL02672:Sptbn1	APN	11	30137239	missense	probably damaging	1.00
IGL02733:Sptbn1	APN	11	30197747	missense	probably benign	0.12
IGL02755:Sptbn1	APN	11	30142247	missense	probably damaging	1.00
R0006:Sptbn1	UTSW	11	30123855	missense	probably damaging	1.00
R0006:Sptbn1	UTSW	11	30123855	missense	probably damaging	1.00
R0096:Sptbn1	UTSW	11	30114739	missense	probably damaging	1.00
R0139:Sptbn1	UTSW	11	30142289	missense	probably benign	0.00
R0370:Sptbn1	UTSW	11	30121545	missense	probably benign
R0389:Sptbn1	UTSW	11	30139250	missense	possibly damaging	0.95
R0415:Sptbn1	UTSW	11	30149576	missense	probably damaging	1.00
R0552:Sptbn1	UTSW	11	30145985	missense	possibly damaging	0.92
R0601:Sptbn1	UTSW	11	30150008	missense	probably damaging	1.00
R0609:Sptbn1	UTSW	11	30138979	missense	probably damaging	1.00
R0675:Sptbn1	UTSW	11	30117903	missense	probably damaging	1.00
R0708:Sptbn1	UTSW	11	30114739	missense	probably damaging	1.00
R0711:Sptbn1	UTSW	11	30114739	missense	probably damaging	1.00
R0729:Sptbn1	UTSW	11	30110902	missense	probably damaging	0.96
R0755:Sptbn1	UTSW	11	30139016	missense	probably damaging	1.00
R0892:Sptbn1	UTSW	11	30142201	missense	probably damaging	1.00
R0927:Sptbn1	UTSW	11	30121591	missense	probably damaging	1.00
R1102:Sptbn1	UTSW	11	30120785	missense	possibly damaging	0.93
R1460:Sptbn1	UTSW	11	30138637	missense	possibly damaging	0.50
R1479:Sptbn1	UTSW	11	30113909	missense	probably damaging	1.00
R1496:Sptbn1	UTSW	11	30121498	missense	probably damaging	1.00
R1649:Sptbn1	UTSW	11	30137301	missense	probably damaging	0.97
R1663:Sptbn1	UTSW	11	30120783	missense	possibly damaging	0.53
R1671:Sptbn1	UTSW	11	30142245	missense	possibly damaging	0.57
R1680:Sptbn1	UTSW	11	30159371	missense	possibly damaging	0.92
R1695:Sptbn1	UTSW	11	30136124	missense	probably benign	0.13
R1868:Sptbn1	UTSW	11	30114781	missense	possibly damaging	0.70
R1918:Sptbn1	UTSW	11	30142414	missense	probably damaging	1.00
R1921:Sptbn1	UTSW	11	30104469	missense	probably damaging	0.98
R2026:Sptbn1	UTSW	11	30104559	missense	probably benign	0.02
R2038:Sptbn1	UTSW	11	30159293	critical splice donor site	probably null
R2047:Sptbn1	UTSW	11	30138360	splice site	probably benign
R2312:Sptbn1	UTSW	11	30154249	missense	probably damaging	1.00
R3430:Sptbn1	UTSW	11	30219686	missense	possibly damaging	0.67
R3624:Sptbn1	UTSW	11	30140593	missense	probably damaging	1.00
R3723:Sptbn1	UTSW	11	30137335	missense	possibly damaging	0.59
R3862:Sptbn1	UTSW	11	30142329	missense	possibly damaging	0.63
R4446:Sptbn1	UTSW	11	30139114	missense	possibly damaging	0.70
R4582:Sptbn1	UTSW	11	30219597	missense	probably damaging	1.00
R4705:Sptbn1	UTSW	11	30100660	missense	probably benign
R4707:Sptbn1	UTSW	11	30137197	missense	possibly damaging	0.61
R4718:Sptbn1	UTSW	11	30154297	missense	probably damaging	1.00
R4789:Sptbn1	UTSW	11	30117759	missense	probably benign
R4824:Sptbn1	UTSW	11	30118295	missense	possibly damaging	0.72
R4855:Sptbn1	UTSW	11	30142353	missense	probably damaging	1.00
R5009:Sptbn1	UTSW	11	30124016	missense	probably benign	0.05
R5071:Sptbn1	UTSW	11	30113854	critical splice donor site	probably null
R5153:Sptbn1	UTSW	11	30121510	missense	possibly damaging	0.82
R5334:Sptbn1	UTSW	11	30137364	missense	possibly damaging	0.92
R5462:Sptbn1	UTSW	11	30100520	missense	possibly damaging	0.94
R5523:Sptbn1	UTSW	11	30137560	missense	probably damaging	1.00
R5707:Sptbn1	UTSW	11	30143174	missense	possibly damaging	0.65
R5724:Sptbn1	UTSW	11	30144113	missense	possibly damaging	0.91
R5738:Sptbn1	UTSW	11	30145941	missense	probably damaging	1.00
R5864:Sptbn1	UTSW	11	30145925	missense	probably damaging	1.00
R5895:Sptbn1	UTSW	11	30123978	missense	probably damaging	0.99
R5932:Sptbn1	UTSW	11	30136136	missense	probably damaging	1.00
R5966:Sptbn1	UTSW	11	30124873	missense	probably damaging	1.00
R5984:Sptbn1	UTSW	11	30118464	missense	probably damaging	1.00
R6155:Sptbn1	UTSW	11	30137403	missense	probably damaging	0.99
R6163:Sptbn1	UTSW	11	30159443	nonsense	probably null
R6226:Sptbn1	UTSW	11	30136054	missense	probably damaging	1.00
R6271:Sptbn1	UTSW	11	30100660	missense	probably benign	0.00
R6443:Sptbn1	UTSW	11	30139429	missense	possibly damaging	0.56
R6591:Sptbn1	UTSW	11	30113984	missense	probably damaging	0.99
R6616:Sptbn1	UTSW	11	30124030	missense	probably benign	0.08
R6691:Sptbn1	UTSW	11	30113984	missense	probably damaging	0.99
R6751:Sptbn1	UTSW	11	30117859	missense	probably damaging	1.00
R6823:Sptbn1	UTSW	11	30114787	missense	probably damaging	1.00
R6863:Sptbn1	UTSW	11	30146777	missense	possibly damaging	0.94
R6885:Sptbn1	UTSW	11	30138634	missense	probably benign	0.26
R6892:Sptbn1	UTSW	11	30142187	missense	probably benign	0.27
R6998:Sptbn1	UTSW	11	30100633	missense	probably damaging	0.97
R7043:Sptbn1	UTSW	11	30103323	missense	probably benign	0.02
R7272:Sptbn1	UTSW	11	30114859	missense	possibly damaging	0.93
R7301:Sptbn1	UTSW	11	30117798	nonsense	probably null
R7379:Sptbn1	UTSW	11	30139292	missense	possibly damaging	0.72
R7774:Sptbn1	UTSW	11	30142142	missense	probably damaging	0.99
R7813:Sptbn1	UTSW	11	30138455	missense	probably damaging	1.00
R7837:Sptbn1	UTSW	11	30138832	missense	probably damaging	1.00
R7843:Sptbn1	UTSW	11	30154320	missense	probably damaging	1.00
R7846:Sptbn1	UTSW	11	30142153	missense	probably damaging	0.98
R7877:Sptbn1	UTSW	11	30129601	missense	possibly damaging	0.94
R7902:Sptbn1	UTSW	11	30136048	missense	probably damaging	1.00
R8060:Sptbn1	UTSW	11	30101616	missense	probably damaging	0.99
R8116:Sptbn1	UTSW	11	30139117	missense	probably damaging	1.00
R8169:Sptbn1	UTSW	11	30197783	missense	possibly damaging	0.62
R8208:Sptbn1	UTSW	11	30124972	missense	probably damaging	1.00
R8247:Sptbn1	UTSW	11	30113906	missense	possibly damaging	0.84
R8412:Sptbn1	UTSW	11	30138457	missense	probably damaging	1.00
Z1176:Sptbn1	UTSW	11	30137439	missense	probably damaging	1.00
Z1176:Sptbn1	UTSW	11	30197787	missense	probably benign	0.13
Z1177:Sptbn1	UTSW	11	30114734	missense	probably damaging	1.00
Z1177:Sptbn1	UTSW	11	30120659	missense	probably benign	0.27

Predicted Primers

PCR Primer
(F):5'- AGGAACTGCTGGTAGGCATG -3'
(R):5'- CCGAGATCAGTGATGTGTGG -3'

Sequencing Primer
(F):5'- ACTGGGAGAGGAGGTTTTGCC -3'
(R):5'- GGAAATGAAGACAACCCTGAAGAACC -3'

Posted On

2019-05-15