Incidental Mutation 'R0615:Ntrk2'
ID55031
Institutional Source Beutler Lab
Gene Symbol Ntrk2
Ensembl Gene ENSMUSG00000055254
Gene Nameneurotrophic tyrosine kinase, receptor, type 2
SynonymsC030027L06Rik, Tkrb, trkB
MMRRC Submission 038804-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.865) question?
Stock #R0615 (G1)
Quality Score221
Status Validated
Chromosome13
Chromosomal Location58806569-59133970 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 59128186 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 767 (Q767*)
Ref Sequence ENSEMBL: ENSMUSP00000153553 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079828] [ENSMUST00000225488]
Predicted Effect probably null
Transcript: ENSMUST00000079828
AA Change: Q767*
SMART Domains Protein: ENSMUSP00000078757
Gene: ENSMUSG00000055254
AA Change: Q767*

DomainStartEndE-ValueType
LRRNT 31 65 1.74e-4 SMART
LRRCT 148 195 8.56e-10 SMART
IGc2 209 273 4.43e-5 SMART
Pfam:I-set 298 377 1.2e-8 PFAM
transmembrane domain 431 453 N/A INTRINSIC
TyrKc 537 806 2.48e-142 SMART
Predicted Effect probably null
Transcript: ENSMUST00000225488
AA Change: Q767*
Meta Mutation Damage Score 0.9717 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurotrophic tyrosine receptor kinase (NTRK) family. This kinase is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. Signalling through this kinase leads to cell differentiation. Mutations in this gene have been associated with obesity and mood disorders. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Different lines of homozygous mice show varied abnormalities including innervation and neural defects, rod defects, impaired ovarian folliculogenesis, and reduced postnatal survival. Homozygotes for a point mutation are normal, but are subject to pharmacological control of signalling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik C A 11: 29,824,515 R314L probably damaging Het
4933411K16Rik T C 19: 42,052,523 I31T possibly damaging Het
Abca13 A G 11: 9,256,197 I166V probably damaging Het
Acaa2 G T 18: 74,798,446 V238L probably benign Het
Ahsg A T 16: 22,899,055 I296F possibly damaging Het
Aspm T A 1: 139,487,289 V1436D probably damaging Het
Ate1 A T 7: 130,513,833 probably benign Het
Atp1a4 A T 1: 172,232,060 probably benign Het
Aurkc A T 7: 7,002,403 I223L possibly damaging Het
Bckdha G T 7: 25,641,785 D50E probably benign Het
Brf2 C T 8: 27,124,031 E376K probably benign Het
Cdk9 C A 2: 32,709,801 L141F possibly damaging Het
Cgn A C 3: 94,770,714 probably benign Het
Clcn1 G A 6: 42,305,575 V526I probably damaging Het
Cnot2 A G 10: 116,498,236 V343A possibly damaging Het
Commd2 A T 3: 57,646,695 V195D possibly damaging Het
Cubn C T 2: 13,360,252 probably null Het
Eif2ak4 C T 2: 118,436,185 T729M probably damaging Het
Elac1 A T 18: 73,738,883 V347E probably damaging Het
Fam209 T C 2: 172,474,133 S143P probably benign Het
Fam20c G A 5: 138,807,486 R454Q probably damaging Het
Fam214a T A 9: 75,004,288 Y14N probably damaging Het
Faxc C T 4: 21,958,608 S255L probably benign Het
Foxj1 T C 11: 116,334,082 D153G possibly damaging Het
Gm6605 C A 7: 38,448,275 noncoding transcript Het
Lmo7 T A 14: 101,876,859 Y12* probably null Het
Matn3 T G 12: 8,963,594 C425W probably damaging Het
Mmd2 A T 5: 142,564,913 M190K probably benign Het
Morn2 A T 17: 80,295,597 T102S probably damaging Het
Nr3c2 A C 8: 77,185,889 T710P probably benign Het
Nrros C A 16: 32,144,085 L343F probably damaging Het
Olfr1297 C T 2: 111,621,919 D52N possibly damaging Het
Olfr92 G C 17: 37,111,455 L176V probably benign Het
Plekhf2 C T 4: 10,991,330 R4H probably benign Het
Ppox A G 1: 171,277,814 probably benign Het
Qprt T A 7: 127,109,076 D61V probably damaging Het
Reln A G 5: 22,010,150 V1101A probably benign Het
Sbno1 T C 5: 124,410,139 N124D probably damaging Het
Scx C T 15: 76,458,095 P165L probably benign Het
Sema6d T C 2: 124,654,135 probably benign Het
Serf2 T C 2: 121,450,855 F92L probably benign Het
Synpo2 A T 3: 123,117,287 N236K probably damaging Het
Tbc1d32 C A 10: 56,224,640 D81Y probably benign Het
Terf2 G A 8: 107,082,990 T232I possibly damaging Het
Tpd52l2 A G 2: 181,501,951 E50G probably damaging Het
Tprn A G 2: 25,264,198 E504G probably damaging Het
Tufm G T 7: 126,487,482 R12L probably benign Het
Vmn2r8 A G 5: 108,799,329 F519S probably damaging Het
Vwa8 T C 14: 78,908,150 V89A probably benign Het
Wnt3 T C 11: 103,812,381 I230T possibly damaging Het
Zan A T 5: 137,468,431 F388Y probably damaging Het
Zfp474 C T 18: 52,638,349 L25F probably benign Het
Other mutations in Ntrk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01928:Ntrk2 APN 13 58846851 missense probably damaging 1.00
IGL02331:Ntrk2 APN 13 58846856 critical splice donor site probably null
IGL02465:Ntrk2 APN 13 59060380 missense probably damaging 1.00
PIT4366001:Ntrk2 UTSW 13 59060335 missense probably damaging 1.00
R0102:Ntrk2 UTSW 13 58808793 missense probably benign 0.00
R0547:Ntrk2 UTSW 13 58874370 missense probably damaging 0.99
R0620:Ntrk2 UTSW 13 58846821 missense probably benign
R1770:Ntrk2 UTSW 13 58861318 missense possibly damaging 0.67
R2063:Ntrk2 UTSW 13 58859297 missense probably damaging 1.00
R2089:Ntrk2 UTSW 13 58859301 missense possibly damaging 0.95
R2091:Ntrk2 UTSW 13 58859301 missense possibly damaging 0.95
R2091:Ntrk2 UTSW 13 58859301 missense possibly damaging 0.95
R2178:Ntrk2 UTSW 13 58808802 missense probably benign 0.06
R2275:Ntrk2 UTSW 13 58861351 missense probably damaging 1.00
R2370:Ntrk2 UTSW 13 59054434 missense probably benign 0.28
R2413:Ntrk2 UTSW 13 58874412 missense possibly damaging 0.56
R2520:Ntrk2 UTSW 13 59054276 intron probably null
R2926:Ntrk2 UTSW 13 59060284 missense probably damaging 1.00
R4163:Ntrk2 UTSW 13 58860240 missense probably damaging 1.00
R4320:Ntrk2 UTSW 13 58860146 missense possibly damaging 0.48
R4348:Ntrk2 UTSW 13 58878259 missense probably damaging 1.00
R4440:Ntrk2 UTSW 13 59060312 missense probably damaging 1.00
R4534:Ntrk2 UTSW 13 59126529 missense probably damaging 1.00
R4695:Ntrk2 UTSW 13 59126493 missense probably damaging 0.99
R5356:Ntrk2 UTSW 13 59060242 missense probably damaging 1.00
R5471:Ntrk2 UTSW 13 58871760 missense probably benign 0.01
R5750:Ntrk2 UTSW 13 58808922 missense probably benign 0.02
R5916:Ntrk2 UTSW 13 58808729 start codon destroyed probably null 0.98
R5972:Ntrk2 UTSW 13 58837819 missense probably damaging 1.00
R6015:Ntrk2 UTSW 13 59060395 missense probably damaging 1.00
R6298:Ntrk2 UTSW 13 58871756 nonsense probably null
R6419:Ntrk2 UTSW 13 58861299 nonsense probably null
R6488:Ntrk2 UTSW 13 58861356 missense possibly damaging 0.93
R6611:Ntrk2 UTSW 13 59054414 missense probably damaging 1.00
R6827:Ntrk2 UTSW 13 59126568 missense probably damaging 1.00
R6911:Ntrk2 UTSW 13 58859215 missense probably damaging 1.00
R7387:Ntrk2 UTSW 13 58985979 missense probably damaging 1.00
R7445:Ntrk2 UTSW 13 58846762 missense probably benign 0.03
R7561:Ntrk2 UTSW 13 58861388 missense probably benign 0.31
R8031:Ntrk2 UTSW 13 58874379 missense probably benign
R8044:Ntrk2 UTSW 13 59126499 missense probably damaging 1.00
Z1176:Ntrk2 UTSW 13 58874333 missense probably benign
Z1177:Ntrk2 UTSW 13 58859273 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGAGGTAAGCAATGTAATCCCGC -3'
(R):5'- GCAGTCAAGAGGTTCGTCGTGTAG -3'

Sequencing Primer
(F):5'- AAAGAAAGGAGAGGCCCTTCCT -3'
(R):5'- CGTGTAGGCCAGTCTGAG -3'
Posted On2013-07-11