Mutagenetix > Incidental Mutations

Incidental Mutation 'R7092:Ror2'

550312

Institutional Source

Beutler Lab

Gene Symbol

Ror2

Ensembl Gene

ENSMUSG00000021464

Gene Name

receptor tyrosine kinase-like orphan receptor 2

Synonyms

Ntrkr2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7092 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

53109312-53286124 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 53110236 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 940 (V940G)

Ref Sequence

ENSEMBL: ENSMUSP00000021918 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021918] [ENSMUST00000130235]

Predicted Effect

probably benign
Transcript: ENSMUST00000021918
AA Change: V940G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000021918
Gene: ENSMUSG00000021464
AA Change: V940G

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
IGc2	74	142	5.23e-16	SMART
Pfam:Fz	174	294	1.2e-12	PFAM
KR	314	396	3.94e-45	SMART
transmembrane domain	403	425	N/A	INTRINSIC
TyrKc	473	746	1.96e-113	SMART
low complexity region	765	783	N/A	INTRINSIC
low complexity region	788	801	N/A	INTRINSIC
low complexity region	839	859	N/A	INTRINSIC
low complexity region	860	872	N/A	INTRINSIC
low complexity region	905	924	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000130235
AA Change: V928G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000123362
Gene: ENSMUSG00000021464
AA Change: V928G

Domain	Start	End	E-Value	Type
IGc2	62	130	5.23e-16	SMART
Pfam:Fz	162	289	3.2e-26	PFAM
KR	302	384	3.94e-45	SMART
transmembrane domain	391	413	N/A	INTRINSIC
TyrKc	461	734	1.96e-113	SMART
low complexity region	753	771	N/A	INTRINSIC
low complexity region	776	789	N/A	INTRINSIC
low complexity region	827	847	N/A	INTRINSIC
low complexity region	848	860	N/A	INTRINSIC
low complexity region	893	912	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

99% (88/89)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a receptor protein tyrosine kinase and type I transmembrane protein that belongs to the ROR subfamily of cell surface receptors. The protein may be involved in the early formation of the chondrocytes and may be required for cartilage and growth plate development. Mutations in this gene can cause brachydactyly type B, a skeletal disorder characterized by hypoplasia/aplasia of distal phalanges and nails. In addition, mutations in this gene can cause the autosomal recessive form of Robinow syndrome, which is characterized by skeletal dysplasia with generalized limb bone shortening, segmental defects of the spine, brachydactyly, and a dysmorphic facial appearance. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for some disruptions in this gene die within the first few hours after birth. They display respiratory and cardiovascular abnormalities as well as a variety of skeletal defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1300017J02Rik	G	A	9: 103,281,043	S106L	possibly damaging	Het
1700034I23Rik	T	A	3: 40,902,374	D22V	possibly damaging	Het
4922502D21Rik	T	A	6: 129,323,000	T172S	probably benign	Het
4930579F01Rik	C	T	3: 138,183,745	C37Y	probably benign	Het
8430408G22Rik	C	A	6: 116,651,788	P31T	probably damaging	Het
A430005L14Rik	T	A	4: 153,960,994		probably null	Het
Abca4	C	G	3: 122,138,569	P1499A	probably damaging	Het
Adcy8	T	C	15: 64,871,770	N330D	possibly damaging	Het
Arfgef1	A	G	1: 10,153,676	Y1466H	probably damaging	Het
Asz1	A	C	6: 18,071,819		probably null	Het
Atad5	T	A	11: 80,120,720	N1307K	possibly damaging	Het
B4galnt4	C	A	7: 141,068,636	F688L	probably damaging	Het
Birc6	C	T	17: 74,646,745	T3349I	probably damaging	Het
Ccp110	C	A	7: 118,735,271	A989E	probably benign	Het
Ccser2	A	G	14: 36,940,655	S191P	probably benign	Het
Cdca2	A	G	14: 67,707,351		probably null	Het
Cdcp1	T	A	9: 123,183,613	T290S	probably benign	Het
Cnnm1	T	C	19: 43,441,948	Y502H	probably damaging	Het
Cyba	T	G	8: 122,427,698	T29P	probably damaging	Het
Dcaf12	A	T	4: 41,301,366	I190N	probably damaging	Het
Epha1	T	C	6: 42,364,245	T512A	probably benign	Het
Fancg	G	A	4: 43,004,831	P454L	probably benign	Het
Fasn	A	C	11: 120,820,120	V268G	possibly damaging	Het
Fgfr1op	C	T	17: 8,172,970	P161S	probably benign	Het
Fip1l1	T	A	5: 74,536,843	L42Q	probably damaging	Het
Fjx1	A	G	2: 102,450,756	L278P	possibly damaging	Het
Fsd1	G	A	17: 55,993,876	R245H	probably damaging	Het
Gm1527	T	A	3: 28,914,547		probably null	Het
Gm8298	T	C	3: 59,861,079	F10S	probably benign	Het
Gng3	T	A	19: 8,838,247	M42L	probably benign	Het
Gsdmc2	T	A	15: 63,825,098	Q408L	probably damaging	Het
Gtpbp3	T	A	8: 71,492,265	I388K	probably benign	Het
Hmcn1	A	T	1: 150,604,246	W4534R	probably damaging	Het
Ist1	A	T	8: 109,682,596		probably null	Het
Kif1bp	C	A	10: 62,578,300	K26N	probably damaging	Het
Kyat3	T	C	3: 142,729,795	I276T	probably damaging	Het
Lipm	C	T	19: 34,121,358	P411S	possibly damaging	Het
Lipo3	T	C	19: 33,613,692		probably null	Het
Lrrc9	C	A	12: 72,463,464	Q446K	possibly damaging	Het
Mfsd4a	G	T	1: 132,067,663	T77N	probably benign	Het
Mmp1b	T	A	9: 7,386,981	D77V	probably damaging	Het
Mrgprb4	A	G	7: 48,198,236	S315P	probably benign	Het
Mroh2b	C	A	15: 4,934,678	N887K	possibly damaging	Het
Mto1	A	G	9: 78,470,673	K599R	probably benign	Het
Muc5ac	T	C	7: 141,809,648		probably benign	Het
Muc5ac	G	C	7: 141,809,687		probably benign	Het
Mylk2	A	G	2: 152,915,190	N295S	probably benign	Het
Nr1i3	G	A	1: 171,214,178		probably null	Het
Nup107	T	C	10: 117,790,494	K25E	probably damaging	Het
Odc1	G	A	12: 17,548,313	V152I	possibly damaging	Het
Olfr1022	A	T	2: 85,868,607	N5I	probably damaging	Het
Olfr364-ps1	T	A	2: 37,146,611	M133K	probably damaging	Het
Olfr53	G	A	7: 140,652,237	G86D	probably benign	Het
Olfr828	G	A	9: 18,816,057	P79L	probably damaging	Het
Pde1b	G	T	15: 103,527,031	V438L	probably benign	Het
Pde4b	G	A	4: 102,601,851	V523M	probably damaging	Het
Pdgfc	C	T	3: 81,204,352	P205S	probably damaging	Het
Per2	A	G	1: 91,421,431	S1073P	probably damaging	Het
Plekhg5	C	T	4: 152,114,508	T1051I	probably damaging	Het
Ppme1	A	T	7: 100,371,822	M1K	probably null	Het
Prokr2	A	T	2: 132,381,316	V102D	possibly damaging	Het
Ptk2	G	A	15: 73,221,809	P854S	possibly damaging	Het
Ptprh	C	A	7: 4,580,861		probably null	Het
Rbsn	T	C	6: 92,189,626	N679S	probably damaging	Het
Rce1	T	C	19: 4,623,090	T303A	probably damaging	Het
Rnf123	C	A	9: 108,068,600	R329L	probably benign	Het
Robo2	T	A	16: 73,956,643	N782I	probably damaging	Het
Rpe65	C	T	3: 159,615,591	R347C	probably damaging	Het
Rrp8	A	T	7: 105,734,109	F317I	probably damaging	Het
Sidt1	A	G	16: 44,299,829	V163A	possibly damaging	Het
Sin3b	T	C	8: 72,747,870		probably null	Het
Slamf1	A	G	1: 171,777,189	T176A	probably benign	Het
Slc12a4	G	T	8: 105,945,223	A922D	probably damaging	Het
Slco1a5	T	A	6: 142,248,675	Q414L	probably benign	Het
Snx11	C	A	11: 96,772,839	R58L	probably damaging	Het
Sp9	A	G	2: 73,273,771	D223G	probably damaging	Het
Sptbn1	T	C	11: 30,137,119	I1107V	possibly damaging	Het
Stap2	T	C	17: 56,002,954	R66G	probably benign	Het
Synrg	T	G	11: 84,008,857	F552V	possibly damaging	Het
Trim60	C	T	8: 65,001,048	R183H	probably benign	Het
Ttn	T	C	2: 76,903,416	D4505G	unknown	Het
Ubxn4	A	G	1: 128,252,222	I34M	probably benign	Het
Vac14	T	A	8: 110,715,496	M702K	probably damaging	Het
Vmn1r43	T	C	6: 89,869,903	I200M	probably benign	Het
Vmn2r108	T	A	17: 20,481,076	Y54F	probably benign	Het
Vps13b	T	C	15: 35,640,634	Y1382H	probably damaging	Het
Wdr72	T	C	9: 74,210,472	I834T	probably damaging	Het
Zfp970	T	A	2: 177,475,292	C220S	probably damaging	Het
Zkscan5	T	G	5: 145,220,089	I467S	probably benign	Het

Other mutations in Ror2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Ror2	APN	13	53113082	missense	probably benign	0.01
IGL01523:Ror2	APN	13	53118963	missense	probably benign	0.02
IGL01599:Ror2	APN	13	53111617	missense	probably damaging	1.00
IGL01669:Ror2	APN	13	53111088	missense	probably damaging	1.00
IGL02016:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02138:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02139:Ror2	APN	13	53111164	missense	probably damaging	1.00
IGL02172:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02173:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02176:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02177:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02178:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02179:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02182:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02189:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02190:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02203:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02230:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02231:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02234:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02423:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02424:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02478:Ror2	APN	13	53121667	missense	probably damaging	1.00
IGL02479:Ror2	APN	13	53131932	missense	possibly damaging	0.62
IGL02517:Ror2	APN	13	53118840	missense	probably damaging	1.00
IGL02554:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02618:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02619:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02622:Ror2	APN	13	53110728	missense	probably damaging	1.00
IGL02623:Ror2	APN	13	53110728	missense	probably damaging	1.00
willowy	UTSW	13	53131919	missense	probably damaging	1.00
R0076:Ror2	UTSW	13	53113074	missense	probably benign	0.02
R0375:Ror2	UTSW	13	53132004	missense	probably damaging	1.00
R0826:Ror2	UTSW	13	53113217	missense	probably damaging	1.00
R1823:Ror2	UTSW	13	53110305	missense	probably benign	0.07
R1895:Ror2	UTSW	13	53131849	missense	probably damaging	1.00
R1946:Ror2	UTSW	13	53131849	missense	probably damaging	1.00
R1983:Ror2	UTSW	13	53110408	missense	probably benign	0.01
R2031:Ror2	UTSW	13	53117330	missense	probably benign	0.01
R2197:Ror2	UTSW	13	53285780	critical splice donor site	probably null
R2246:Ror2	UTSW	13	53111602	missense	probably damaging	1.00
R2405:Ror2	UTSW	13	53130944	missense	possibly damaging	0.67
R2411:Ror2	UTSW	13	53130944	missense	possibly damaging	0.67
R2905:Ror2	UTSW	13	53131995	missense	probably benign	0.01
R3156:Ror2	UTSW	13	53117364	missense	probably damaging	0.98
R4198:Ror2	UTSW	13	53110644	missense	probably benign	0.08
R4408:Ror2	UTSW	13	53118961	missense	probably damaging	1.00
R4469:Ror2	UTSW	13	53131980	missense	possibly damaging	0.87
R4648:Ror2	UTSW	13	53285500	nonsense	probably null
R4705:Ror2	UTSW	13	53117297	missense	probably benign	0.00
R4824:Ror2	UTSW	13	53110683	missense	probably benign	0.10
R4831:Ror2	UTSW	13	53118844	missense	probably damaging	0.97
R4951:Ror2	UTSW	13	53117147	missense	probably benign	0.00
R4975:Ror2	UTSW	13	53131918	missense	probably damaging	1.00
R5380:Ror2	UTSW	13	53117149	missense	possibly damaging	0.73
R5469:Ror2	UTSW	13	53117339	missense	probably benign	0.00
R5604:Ror2	UTSW	13	53117165	missense	probably benign	0.01
R6188:Ror2	UTSW	13	53111311	missense	probably damaging	0.98
R6221:Ror2	UTSW	13	53113217	missense	probably damaging	1.00
R6243:Ror2	UTSW	13	53113080	missense	probably benign
R6255:Ror2	UTSW	13	53110542	missense	probably damaging	1.00
R6497:Ror2	UTSW	13	53131919	missense	probably damaging	1.00
R6717:Ror2	UTSW	13	53118982	missense	probably damaging	1.00
R6918:Ror2	UTSW	13	53111451	missense	probably damaging	0.96
R7134:Ror2	UTSW	13	53146706	missense	probably benign	0.00
R7254:Ror2	UTSW	13	53118720	missense	possibly damaging	0.72
R7517:Ror2	UTSW	13	53110865	missense	possibly damaging	0.86
R7560:Ror2	UTSW	13	53110813	missense	probably benign	0.05
R7746:Ror2	UTSW	13	53117225	missense	probably damaging	1.00
R8031:Ror2	UTSW	13	53113157	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTCTGAAATGGCCTCCAGC -3'
(R):5'- CCAATACATCTGTGGCGGAC -3'

Sequencing Primer
(F):5'- CAGCGGCAGTTTTATGGGCAC -3'
(R):5'- CGAGGATGCACAGAACAT -3'

Posted On

2019-05-15