Incidental Mutation 'R7092:Vps13b'
ID 550316
Institutional Source Beutler Lab
Gene Symbol Vps13b
Ensembl Gene ENSMUSG00000037646
Gene Name vacuolar protein sorting 13B
Synonyms 1810042B05Rik, C330002D13Rik, 2310042E16Rik, Coh1
MMRRC Submission 045186-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7092 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 35371306-35931375 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 35640780 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 1382 (Y1382H)
Ref Sequence ENSEMBL: ENSMUSP00000045490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048646]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000048646
AA Change: Y1382H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045490
Gene: ENSMUSG00000037646
AA Change: Y1382H

DomainStartEndE-ValueType
Pfam:Chorein_N 2 120 1e-29 PFAM
low complexity region 128 137 N/A INTRINSIC
low complexity region 143 160 N/A INTRINSIC
low complexity region 975 984 N/A INTRINSIC
low complexity region 1007 1018 N/A INTRINSIC
low complexity region 1876 1883 N/A INTRINSIC
low complexity region 2042 2054 N/A INTRINSIC
low complexity region 2414 2423 N/A INTRINSIC
Pfam:SHR-BD 2601 2700 8.4e-10 PFAM
low complexity region 2954 2964 N/A INTRINSIC
Pfam:VPS13_C 3539 3706 2.6e-30 PFAM
Meta Mutation Damage Score 0.2436 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (88/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a potential transmembrane protein that may function in vesicle-mediated transport and sorting of proteins within the cell. This protein may play a role in the development and the function of the eye, hematological system, and central nervous system. Mutations in this gene have been associated with Cohen syndrome. Multiple splice variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik C T 3: 137,889,506 (GRCm39) C37Y probably benign Het
A430005L14Rik T A 4: 154,045,451 (GRCm39) probably null Het
Aadacl2fm3 T C 3: 59,768,500 (GRCm39) F10S probably benign Het
Abca4 C G 3: 121,932,218 (GRCm39) P1499A probably damaging Het
Adcy8 T C 15: 64,743,619 (GRCm39) N330D possibly damaging Het
Arfgef1 A G 1: 10,223,901 (GRCm39) Y1466H probably damaging Het
Asz1 A C 6: 18,071,818 (GRCm39) probably null Het
Atad5 T A 11: 80,011,546 (GRCm39) N1307K possibly damaging Het
B4galnt4 C A 7: 140,648,549 (GRCm39) F688L probably damaging Het
Birc6 C T 17: 74,953,740 (GRCm39) T3349I probably damaging Het
Ccp110 C A 7: 118,334,494 (GRCm39) A989E probably benign Het
Ccser2 A G 14: 36,662,612 (GRCm39) S191P probably benign Het
Cdca2 A G 14: 67,944,800 (GRCm39) probably null Het
Cdcp1 T A 9: 123,012,678 (GRCm39) T290S probably benign Het
Cep43 C T 17: 8,391,802 (GRCm39) P161S probably benign Het
Clec2m T A 6: 129,299,963 (GRCm39) T172S probably benign Het
Cnnm1 T C 19: 43,430,387 (GRCm39) Y502H probably damaging Het
Cyba T G 8: 123,154,437 (GRCm39) T29P probably damaging Het
Dcaf12 A T 4: 41,301,366 (GRCm39) I190N probably damaging Het
Depp1 C A 6: 116,628,749 (GRCm39) P31T probably damaging Het
Epha1 T C 6: 42,341,179 (GRCm39) T512A probably benign Het
Fancg G A 4: 43,004,831 (GRCm39) P454L probably benign Het
Fasn A C 11: 120,710,946 (GRCm39) V268G possibly damaging Het
Fip1l1 T A 5: 74,697,504 (GRCm39) L42Q probably damaging Het
Fjx1 A G 2: 102,281,101 (GRCm39) L278P possibly damaging Het
Fsd1 G A 17: 56,300,876 (GRCm39) R245H probably damaging Het
Fundc2b T A 3: 40,856,809 (GRCm39) D22V possibly damaging Het
Gm1527 T A 3: 28,968,696 (GRCm39) probably null Het
Gng3 T A 19: 8,815,611 (GRCm39) M42L probably benign Het
Gsdmc2 T A 15: 63,696,947 (GRCm39) Q408L probably damaging Het
Gtpbp3 T A 8: 71,944,909 (GRCm39) I388K probably benign Het
Hmcn1 A T 1: 150,479,997 (GRCm39) W4534R probably damaging Het
Inhca G A 9: 103,158,242 (GRCm39) S106L possibly damaging Het
Ist1 A T 8: 110,409,228 (GRCm39) probably null Het
Kifbp C A 10: 62,414,079 (GRCm39) K26N probably damaging Het
Kyat3 T C 3: 142,435,556 (GRCm39) I276T probably damaging Het
Lipm C T 19: 34,098,758 (GRCm39) P411S possibly damaging Het
Lipo3 T C 19: 33,591,092 (GRCm39) probably null Het
Lrrc9 C A 12: 72,510,238 (GRCm39) Q446K possibly damaging Het
Mfsd4a G T 1: 131,995,401 (GRCm39) T77N probably benign Het
Mmp1b T A 9: 7,386,981 (GRCm39) D77V probably damaging Het
Mrgprb4 A G 7: 47,847,984 (GRCm39) S315P probably benign Het
Mroh2b C A 15: 4,964,160 (GRCm39) N887K possibly damaging Het
Mto1 A G 9: 78,377,955 (GRCm39) K599R probably benign Het
Muc5ac G C 7: 141,363,424 (GRCm39) probably benign Het
Muc5ac T C 7: 141,363,385 (GRCm39) probably benign Het
Mylk2 A G 2: 152,757,110 (GRCm39) N295S probably benign Het
Nr1i3 G A 1: 171,041,747 (GRCm39) probably null Het
Nup107 T C 10: 117,626,399 (GRCm39) K25E probably damaging Het
Odc1 G A 12: 17,598,314 (GRCm39) V152I possibly damaging Het
Or13a20 G A 7: 140,232,150 (GRCm39) G86D probably benign Het
Or1l4b T A 2: 37,036,623 (GRCm39) M133K probably damaging Het
Or5m10b A T 2: 85,698,951 (GRCm39) N5I probably damaging Het
Or7g16 G A 9: 18,727,353 (GRCm39) P79L probably damaging Het
Pde1b G T 15: 103,435,458 (GRCm39) V438L probably benign Het
Pde4b G A 4: 102,459,048 (GRCm39) V523M probably damaging Het
Pdgfc C T 3: 81,111,659 (GRCm39) P205S probably damaging Het
Per2 A G 1: 91,349,153 (GRCm39) S1073P probably damaging Het
Plekhg5 C T 4: 152,198,965 (GRCm39) T1051I probably damaging Het
Ppme1 A T 7: 100,021,029 (GRCm39) M1K probably null Het
Prokr2 A T 2: 132,223,236 (GRCm39) V102D possibly damaging Het
Ptk2 G A 15: 73,093,658 (GRCm39) P854S possibly damaging Het
Ptprh C A 7: 4,583,860 (GRCm39) probably null Het
Rbsn T C 6: 92,166,607 (GRCm39) N679S probably damaging Het
Rce1 T C 19: 4,673,118 (GRCm39) T303A probably damaging Het
Rnf123 C A 9: 107,945,799 (GRCm39) R329L probably benign Het
Robo2 T A 16: 73,753,531 (GRCm39) N782I probably damaging Het
Ror2 A C 13: 53,264,272 (GRCm39) V940G probably benign Het
Rpe65 C T 3: 159,321,228 (GRCm39) R347C probably damaging Het
Rrp8 A T 7: 105,383,316 (GRCm39) F317I probably damaging Het
Sidt1 A G 16: 44,120,192 (GRCm39) V163A possibly damaging Het
Sin3b T C 8: 73,474,498 (GRCm39) probably null Het
Slamf1 A G 1: 171,604,757 (GRCm39) T176A probably benign Het
Slc12a4 G T 8: 106,671,855 (GRCm39) A922D probably damaging Het
Slco1a5 T A 6: 142,194,401 (GRCm39) Q414L probably benign Het
Snx11 C A 11: 96,663,665 (GRCm39) R58L probably damaging Het
Sp9 A G 2: 73,104,115 (GRCm39) D223G probably damaging Het
Sptbn1 T C 11: 30,087,119 (GRCm39) I1107V possibly damaging Het
Stap2 T C 17: 56,309,954 (GRCm39) R66G probably benign Het
Synrg T G 11: 83,899,683 (GRCm39) F552V possibly damaging Het
Trim60 C T 8: 65,453,700 (GRCm39) R183H probably benign Het
Ttn T C 2: 76,733,760 (GRCm39) D4505G unknown Het
Ubxn4 A G 1: 128,179,959 (GRCm39) I34M probably benign Het
Vac14 T A 8: 111,442,128 (GRCm39) M702K probably damaging Het
Vmn1r43 T C 6: 89,846,885 (GRCm39) I200M probably benign Het
Vmn2r108 T A 17: 20,701,338 (GRCm39) Y54F probably benign Het
Wdr72 T C 9: 74,117,754 (GRCm39) I834T probably damaging Het
Zfp970 T A 2: 177,167,085 (GRCm39) C220S probably damaging Het
Zkscan5 T G 5: 145,156,899 (GRCm39) I467S probably benign Het
Other mutations in Vps13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Vps13b APN 15 35,926,372 (GRCm39) missense possibly damaging 0.52
IGL00513:Vps13b APN 15 35,794,030 (GRCm39) missense probably damaging 1.00
IGL00516:Vps13b APN 15 35,640,703 (GRCm39) missense probably damaging 1.00
IGL00640:Vps13b APN 15 35,417,723 (GRCm39) missense probably benign
IGL00753:Vps13b APN 15 35,372,177 (GRCm39) missense probably damaging 0.99
IGL00784:Vps13b APN 15 35,847,046 (GRCm39) missense probably damaging 1.00
IGL01138:Vps13b APN 15 35,446,916 (GRCm39) splice site probably benign
IGL01349:Vps13b APN 15 35,794,091 (GRCm39) missense probably benign 0.00
IGL01403:Vps13b APN 15 35,709,625 (GRCm39) missense probably benign 0.00
IGL01535:Vps13b APN 15 35,455,103 (GRCm39) missense possibly damaging 0.67
IGL01571:Vps13b APN 15 35,877,635 (GRCm39) splice site probably benign
IGL01642:Vps13b APN 15 35,792,218 (GRCm39) missense probably benign 0.43
IGL01658:Vps13b APN 15 35,671,479 (GRCm39) missense probably damaging 0.99
IGL01759:Vps13b APN 15 35,878,935 (GRCm39) missense probably damaging 1.00
IGL01763:Vps13b APN 15 35,709,945 (GRCm39) missense possibly damaging 0.72
IGL01906:Vps13b APN 15 35,639,993 (GRCm39) splice site probably benign
IGL01982:Vps13b APN 15 35,439,050 (GRCm39) nonsense probably null
IGL01997:Vps13b APN 15 35,709,370 (GRCm39) missense probably damaging 1.00
IGL02041:Vps13b APN 15 35,423,391 (GRCm39) missense probably damaging 0.98
IGL02073:Vps13b APN 15 35,875,732 (GRCm39) missense possibly damaging 0.52
IGL02077:Vps13b APN 15 35,910,759 (GRCm39) missense possibly damaging 0.68
IGL02141:Vps13b APN 15 35,572,227 (GRCm39) missense probably benign 0.09
IGL02146:Vps13b APN 15 35,646,479 (GRCm39) missense probably benign 0.36
IGL02197:Vps13b APN 15 35,930,202 (GRCm39) missense probably benign 0.02
IGL02311:Vps13b APN 15 35,709,660 (GRCm39) missense probably benign 0.08
IGL02466:Vps13b APN 15 35,770,887 (GRCm39) missense possibly damaging 0.86
IGL02506:Vps13b APN 15 35,917,308 (GRCm39) missense probably damaging 1.00
IGL02550:Vps13b APN 15 35,572,242 (GRCm39) missense probably benign
IGL02553:Vps13b APN 15 35,646,447 (GRCm39) missense probably benign 0.00
IGL02674:Vps13b APN 15 35,640,104 (GRCm39) missense probably benign 0.41
IGL02690:Vps13b APN 15 35,917,288 (GRCm39) missense probably damaging 1.00
IGL02731:Vps13b APN 15 35,917,274 (GRCm39) missense probably benign 0.00
IGL02739:Vps13b APN 15 35,880,046 (GRCm39) missense probably damaging 1.00
IGL02868:Vps13b APN 15 35,884,665 (GRCm39) missense probably benign 0.03
IGL03081:Vps13b APN 15 35,875,966 (GRCm39) missense probably damaging 0.97
IGL03178:Vps13b APN 15 35,869,446 (GRCm39) missense probably damaging 1.00
IGL03343:Vps13b APN 15 35,917,316 (GRCm39) missense possibly damaging 0.76
IGL03407:Vps13b APN 15 35,640,012 (GRCm39) missense possibly damaging 0.95
IGL03410:Vps13b APN 15 35,910,486 (GRCm39) missense probably benign
omlette UTSW 15 35,671,546 (GRCm39) missense probably benign 0.13
swiss UTSW 15 35,709,819 (GRCm39) missense possibly damaging 0.80
FR4449:Vps13b UTSW 15 35,847,103 (GRCm39) missense probably damaging 1.00
FR4548:Vps13b UTSW 15 35,847,103 (GRCm39) missense probably damaging 1.00
FR4737:Vps13b UTSW 15 35,847,103 (GRCm39) missense probably damaging 1.00
FR4976:Vps13b UTSW 15 35,847,103 (GRCm39) missense probably damaging 1.00
LCD18:Vps13b UTSW 15 35,847,103 (GRCm39) missense probably damaging 1.00
PIT4531001:Vps13b UTSW 15 35,878,971 (GRCm39) missense probably damaging 1.00
PIT4581001:Vps13b UTSW 15 35,534,409 (GRCm39) missense probably damaging 1.00
PIT4618001:Vps13b UTSW 15 35,709,386 (GRCm39) missense probably damaging 1.00
R0026:Vps13b UTSW 15 35,923,447 (GRCm39) missense possibly damaging 0.62
R0026:Vps13b UTSW 15 35,923,447 (GRCm39) missense possibly damaging 0.62
R0108:Vps13b UTSW 15 35,572,265 (GRCm39) missense probably benign 0.20
R0109:Vps13b UTSW 15 35,572,265 (GRCm39) missense probably benign 0.20
R0109:Vps13b UTSW 15 35,572,265 (GRCm39) missense probably benign 0.20
R0116:Vps13b UTSW 15 35,423,301 (GRCm39) missense probably damaging 0.99
R0123:Vps13b UTSW 15 35,887,407 (GRCm39) missense probably benign 0.01
R0124:Vps13b UTSW 15 35,576,674 (GRCm39) critical splice donor site probably null
R0134:Vps13b UTSW 15 35,887,407 (GRCm39) missense probably benign 0.01
R0137:Vps13b UTSW 15 35,926,365 (GRCm39) missense probably benign 0.06
R0195:Vps13b UTSW 15 35,472,045 (GRCm39) missense probably benign 0.00
R0225:Vps13b UTSW 15 35,887,407 (GRCm39) missense probably benign 0.01
R0320:Vps13b UTSW 15 35,674,974 (GRCm39) missense probably damaging 0.98
R0333:Vps13b UTSW 15 35,879,949 (GRCm39) missense probably damaging 1.00
R0336:Vps13b UTSW 15 35,455,279 (GRCm39) nonsense probably null
R0463:Vps13b UTSW 15 35,597,555 (GRCm39) missense probably damaging 0.98
R0466:Vps13b UTSW 15 35,445,748 (GRCm39) nonsense probably null
R0472:Vps13b UTSW 15 35,417,779 (GRCm39) critical splice donor site probably null
R0523:Vps13b UTSW 15 35,472,196 (GRCm39) missense probably benign 0.20
R0602:Vps13b UTSW 15 35,422,514 (GRCm39) missense probably damaging 1.00
R0612:Vps13b UTSW 15 35,623,803 (GRCm39) missense probably benign 0.12
R0627:Vps13b UTSW 15 35,372,145 (GRCm39) nonsense probably null
R0679:Vps13b UTSW 15 35,709,849 (GRCm39) missense possibly damaging 0.73
R0742:Vps13b UTSW 15 35,794,507 (GRCm39) missense probably benign 0.22
R1053:Vps13b UTSW 15 35,652,509 (GRCm39) missense probably damaging 1.00
R1355:Vps13b UTSW 15 35,422,600 (GRCm39) missense probably damaging 1.00
R1386:Vps13b UTSW 15 35,923,458 (GRCm39) missense probably damaging 0.99
R1403:Vps13b UTSW 15 35,709,268 (GRCm39) splice site probably benign
R1453:Vps13b UTSW 15 35,422,590 (GRCm39) missense probably damaging 0.97
R1464:Vps13b UTSW 15 35,709,630 (GRCm39) missense probably benign 0.14
R1464:Vps13b UTSW 15 35,709,630 (GRCm39) missense probably benign 0.14
R1511:Vps13b UTSW 15 35,841,719 (GRCm39) missense probably benign 0.00
R1511:Vps13b UTSW 15 35,840,121 (GRCm39) missense probably damaging 0.99
R1513:Vps13b UTSW 15 35,438,876 (GRCm39) nonsense probably null
R1536:Vps13b UTSW 15 35,875,712 (GRCm39) missense probably damaging 0.98
R1537:Vps13b UTSW 15 35,792,327 (GRCm39) missense possibly damaging 0.62
R1558:Vps13b UTSW 15 35,534,465 (GRCm39) missense probably damaging 1.00
R1601:Vps13b UTSW 15 35,642,582 (GRCm39) missense probably benign 0.11
R1653:Vps13b UTSW 15 35,607,418 (GRCm39) nonsense probably null
R1695:Vps13b UTSW 15 35,576,667 (GRCm39) missense probably benign 0.05
R1760:Vps13b UTSW 15 35,884,765 (GRCm39) missense possibly damaging 0.54
R1785:Vps13b UTSW 15 35,879,937 (GRCm39) missense probably damaging 1.00
R1786:Vps13b UTSW 15 35,879,937 (GRCm39) missense probably damaging 1.00
R1803:Vps13b UTSW 15 35,430,351 (GRCm39) nonsense probably null
R1804:Vps13b UTSW 15 35,917,283 (GRCm39) missense probably damaging 1.00
R1808:Vps13b UTSW 15 35,792,205 (GRCm39) missense probably benign 0.00
R1817:Vps13b UTSW 15 35,910,788 (GRCm39) missense possibly damaging 0.86
R1818:Vps13b UTSW 15 35,877,723 (GRCm39) missense probably benign 0.00
R1836:Vps13b UTSW 15 35,910,378 (GRCm39) missense probably damaging 0.99
R1850:Vps13b UTSW 15 35,675,105 (GRCm39) splice site probably benign
R1884:Vps13b UTSW 15 35,430,437 (GRCm39) splice site probably benign
R1938:Vps13b UTSW 15 35,709,653 (GRCm39) missense probably damaging 1.00
R1955:Vps13b UTSW 15 35,925,554 (GRCm39) critical splice donor site probably null
R1956:Vps13b UTSW 15 35,869,553 (GRCm39) missense probably damaging 1.00
R1958:Vps13b UTSW 15 35,878,835 (GRCm39) missense probably damaging 0.99
R2013:Vps13b UTSW 15 35,607,288 (GRCm39) missense probably damaging 0.99
R2014:Vps13b UTSW 15 35,607,288 (GRCm39) missense probably damaging 0.99
R2015:Vps13b UTSW 15 35,607,288 (GRCm39) missense probably damaging 0.99
R2038:Vps13b UTSW 15 35,884,887 (GRCm39) missense probably damaging 1.00
R2058:Vps13b UTSW 15 35,841,593 (GRCm39) missense probably damaging 1.00
R2082:Vps13b UTSW 15 35,910,892 (GRCm39) missense possibly damaging 0.70
R2087:Vps13b UTSW 15 35,597,639 (GRCm39) missense probably damaging 0.99
R2124:Vps13b UTSW 15 35,646,226 (GRCm39) missense probably benign 0.08
R2130:Vps13b UTSW 15 35,671,546 (GRCm39) missense probably benign 0.13
R2168:Vps13b UTSW 15 35,792,334 (GRCm39) missense probably damaging 1.00
R2168:Vps13b UTSW 15 35,792,335 (GRCm39) missense probably damaging 1.00
R2171:Vps13b UTSW 15 35,887,343 (GRCm39) missense probably benign 0.44
R2221:Vps13b UTSW 15 35,884,743 (GRCm39) missense probably benign
R2263:Vps13b UTSW 15 35,646,327 (GRCm39) missense probably benign 0.02
R2289:Vps13b UTSW 15 35,572,251 (GRCm39) missense probably damaging 1.00
R2316:Vps13b UTSW 15 35,675,045 (GRCm39) nonsense probably null
R2351:Vps13b UTSW 15 35,869,457 (GRCm39) missense probably damaging 1.00
R2512:Vps13b UTSW 15 35,884,701 (GRCm39) missense probably benign 0.35
R3054:Vps13b UTSW 15 35,646,507 (GRCm39) missense probably damaging 0.99
R3055:Vps13b UTSW 15 35,646,507 (GRCm39) missense probably damaging 0.99
R3196:Vps13b UTSW 15 35,869,541 (GRCm39) missense probably damaging 1.00
R3236:Vps13b UTSW 15 35,910,450 (GRCm39) missense probably benign 0.40
R3404:Vps13b UTSW 15 35,926,200 (GRCm39) missense probably damaging 1.00
R3722:Vps13b UTSW 15 35,671,528 (GRCm39) missense probably damaging 0.99
R4077:Vps13b UTSW 15 35,455,274 (GRCm39) missense probably damaging 0.99
R4153:Vps13b UTSW 15 35,792,173 (GRCm39) splice site probably null
R4224:Vps13b UTSW 15 35,876,565 (GRCm39) missense probably damaging 0.99
R4408:Vps13b UTSW 15 35,709,440 (GRCm39) missense probably damaging 0.98
R4431:Vps13b UTSW 15 35,770,899 (GRCm39) missense probably damaging 1.00
R4449:Vps13b UTSW 15 35,876,939 (GRCm39) missense possibly damaging 0.86
R4508:Vps13b UTSW 15 35,709,819 (GRCm39) missense possibly damaging 0.80
R4631:Vps13b UTSW 15 35,646,278 (GRCm39) missense possibly damaging 0.95
R4655:Vps13b UTSW 15 35,770,835 (GRCm39) missense probably benign
R4666:Vps13b UTSW 15 35,640,690 (GRCm39) missense probably benign 0.13
R4684:Vps13b UTSW 15 35,879,967 (GRCm39) missense probably benign
R4684:Vps13b UTSW 15 35,841,487 (GRCm39) missense probably benign
R4684:Vps13b UTSW 15 35,646,324 (GRCm39) missense probably damaging 0.98
R4721:Vps13b UTSW 15 35,910,864 (GRCm39) nonsense probably null
R4771:Vps13b UTSW 15 35,910,946 (GRCm39) missense probably damaging 1.00
R4830:Vps13b UTSW 15 35,452,370 (GRCm39) missense possibly damaging 0.94
R4835:Vps13b UTSW 15 35,869,518 (GRCm39) missense probably damaging 1.00
R4835:Vps13b UTSW 15 35,910,439 (GRCm39) missense probably benign
R4857:Vps13b UTSW 15 35,456,800 (GRCm39) missense probably benign 0.01
R4891:Vps13b UTSW 15 35,640,661 (GRCm39) splice site probably null
R5095:Vps13b UTSW 15 35,923,348 (GRCm39) missense probably damaging 1.00
R5110:Vps13b UTSW 15 35,770,955 (GRCm39) missense probably damaging 0.99
R5147:Vps13b UTSW 15 35,456,824 (GRCm39) missense probably benign 0.32
R5153:Vps13b UTSW 15 35,422,599 (GRCm39) missense probably damaging 0.99
R5257:Vps13b UTSW 15 35,794,567 (GRCm39) missense possibly damaging 0.75
R5258:Vps13b UTSW 15 35,794,567 (GRCm39) missense possibly damaging 0.75
R5296:Vps13b UTSW 15 35,876,559 (GRCm39) missense probably damaging 1.00
R5386:Vps13b UTSW 15 35,640,674 (GRCm39) critical splice acceptor site probably null
R5396:Vps13b UTSW 15 35,887,094 (GRCm39) missense probably damaging 0.99
R5412:Vps13b UTSW 15 35,533,531 (GRCm39) missense probably damaging 1.00
R5488:Vps13b UTSW 15 35,770,688 (GRCm39) missense probably benign
R5489:Vps13b UTSW 15 35,770,688 (GRCm39) missense probably benign
R5503:Vps13b UTSW 15 35,452,312 (GRCm39) missense probably damaging 0.97
R5575:Vps13b UTSW 15 35,930,065 (GRCm39) missense probably damaging 1.00
R5781:Vps13b UTSW 15 35,794,181 (GRCm39) missense probably damaging 0.97
R5872:Vps13b UTSW 15 35,869,497 (GRCm39) missense possibly damaging 0.56
R5876:Vps13b UTSW 15 35,917,207 (GRCm39) missense probably damaging 0.99
R5994:Vps13b UTSW 15 35,875,918 (GRCm39) missense probably damaging 1.00
R6031:Vps13b UTSW 15 35,472,114 (GRCm39) missense probably damaging 1.00
R6031:Vps13b UTSW 15 35,472,114 (GRCm39) missense probably damaging 1.00
R6045:Vps13b UTSW 15 35,671,462 (GRCm39) missense probably damaging 0.99
R6143:Vps13b UTSW 15 35,668,884 (GRCm39) missense probably damaging 0.99
R6147:Vps13b UTSW 15 35,930,177 (GRCm39) missense probably benign 0.16
R6218:Vps13b UTSW 15 35,770,610 (GRCm39) missense probably benign 0.00
R6447:Vps13b UTSW 15 35,572,272 (GRCm39) missense probably benign 0.02
R6555:Vps13b UTSW 15 35,846,993 (GRCm39) missense probably damaging 1.00
R6578:Vps13b UTSW 15 35,446,247 (GRCm39) missense probably damaging 0.99
R6640:Vps13b UTSW 15 35,617,842 (GRCm39) missense possibly damaging 0.93
R6645:Vps13b UTSW 15 35,910,451 (GRCm39) missense probably benign 0.25
R6711:Vps13b UTSW 15 35,887,395 (GRCm39) missense probably damaging 1.00
R6727:Vps13b UTSW 15 35,770,829 (GRCm39) missense probably benign 0.19
R6737:Vps13b UTSW 15 35,910,757 (GRCm39) missense probably damaging 1.00
R6844:Vps13b UTSW 15 35,877,736 (GRCm39) missense probably benign 0.06
R6849:Vps13b UTSW 15 35,905,455 (GRCm39) missense probably damaging 1.00
R6861:Vps13b UTSW 15 35,576,541 (GRCm39) missense probably damaging 0.99
R6938:Vps13b UTSW 15 35,423,344 (GRCm39) missense probably damaging 0.99
R6943:Vps13b UTSW 15 35,448,835 (GRCm39) missense possibly damaging 0.95
R6989:Vps13b UTSW 15 35,448,727 (GRCm39) missense probably benign 0.02
R7232:Vps13b UTSW 15 35,877,703 (GRCm39) missense probably damaging 1.00
R7307:Vps13b UTSW 15 35,841,691 (GRCm39) missense probably benign
R7400:Vps13b UTSW 15 35,379,046 (GRCm39) missense probably damaging 1.00
R7414:Vps13b UTSW 15 35,910,973 (GRCm39) missense probably damaging 1.00
R7497:Vps13b UTSW 15 35,876,843 (GRCm39) missense probably benign 0.38
R7500:Vps13b UTSW 15 35,910,670 (GRCm39) missense possibly damaging 0.74
R7603:Vps13b UTSW 15 35,576,585 (GRCm39) missense probably damaging 0.98
R7605:Vps13b UTSW 15 35,770,792 (GRCm39) missense probably damaging 0.97
R7849:Vps13b UTSW 15 35,423,378 (GRCm39) missense probably damaging 0.99
R7984:Vps13b UTSW 15 35,880,059 (GRCm39) missense probably benign
R8094:Vps13b UTSW 15 35,669,052 (GRCm39) critical splice donor site probably null
R8097:Vps13b UTSW 15 35,709,492 (GRCm39) missense probably benign 0.38
R8131:Vps13b UTSW 15 35,372,255 (GRCm39) critical splice donor site probably null
R8139:Vps13b UTSW 15 35,607,418 (GRCm39) nonsense probably null
R8174:Vps13b UTSW 15 35,709,456 (GRCm39) nonsense probably null
R8225:Vps13b UTSW 15 35,794,528 (GRCm39) missense probably damaging 0.99
R8239:Vps13b UTSW 15 35,597,550 (GRCm39) missense probably damaging 1.00
R8244:Vps13b UTSW 15 35,917,349 (GRCm39) missense probably damaging 1.00
R8303:Vps13b UTSW 15 35,640,063 (GRCm39) missense probably damaging 1.00
R8311:Vps13b UTSW 15 35,887,100 (GRCm39) missense probably benign 0.37
R8443:Vps13b UTSW 15 35,455,246 (GRCm39) missense probably benign
R8494:Vps13b UTSW 15 35,422,594 (GRCm39) missense probably damaging 0.99
R8499:Vps13b UTSW 15 35,841,466 (GRCm39) missense probably damaging 1.00
R8506:Vps13b UTSW 15 35,446,891 (GRCm39) missense probably benign 0.31
R8559:Vps13b UTSW 15 35,876,788 (GRCm39) missense probably damaging 1.00
R8686:Vps13b UTSW 15 35,925,535 (GRCm39) missense probably damaging 0.99
R8782:Vps13b UTSW 15 35,422,483 (GRCm39) missense possibly damaging 0.93
R8806:Vps13b UTSW 15 35,472,212 (GRCm39) critical splice donor site probably benign
R8824:Vps13b UTSW 15 35,533,445 (GRCm39) missense probably damaging 0.99
R9024:Vps13b UTSW 15 35,923,470 (GRCm39) missense probably damaging 0.97
R9038:Vps13b UTSW 15 35,875,931 (GRCm39) missense possibly damaging 0.70
R9054:Vps13b UTSW 15 35,422,537 (GRCm39) missense probably damaging 1.00
R9091:Vps13b UTSW 15 35,770,919 (GRCm39) missense probably benign 0.13
R9129:Vps13b UTSW 15 35,448,793 (GRCm39) missense probably damaging 1.00
R9214:Vps13b UTSW 15 35,623,892 (GRCm39) missense probably damaging 0.99
R9237:Vps13b UTSW 15 35,841,479 (GRCm39) missense probably damaging 1.00
R9256:Vps13b UTSW 15 35,623,925 (GRCm39) missense possibly damaging 0.95
R9270:Vps13b UTSW 15 35,770,919 (GRCm39) missense probably benign 0.13
R9279:Vps13b UTSW 15 35,572,290 (GRCm39) missense probably damaging 0.97
R9291:Vps13b UTSW 15 35,847,059 (GRCm39) missense probably damaging 1.00
R9342:Vps13b UTSW 15 35,455,200 (GRCm39) missense possibly damaging 0.94
R9404:Vps13b UTSW 15 35,876,565 (GRCm39) missense probably damaging 1.00
R9488:Vps13b UTSW 15 35,447,880 (GRCm39) missense possibly damaging 0.77
R9509:Vps13b UTSW 15 35,841,457 (GRCm39) missense possibly damaging 0.79
R9610:Vps13b UTSW 15 35,642,555 (GRCm39) missense possibly damaging 0.85
R9611:Vps13b UTSW 15 35,642,555 (GRCm39) missense possibly damaging 0.85
R9658:Vps13b UTSW 15 35,623,774 (GRCm39) missense probably benign 0.00
R9674:Vps13b UTSW 15 35,607,380 (GRCm39) missense probably damaging 0.98
R9696:Vps13b UTSW 15 35,675,033 (GRCm39) missense possibly damaging 0.56
R9767:Vps13b UTSW 15 35,910,403 (GRCm39) missense probably damaging 1.00
R9797:Vps13b UTSW 15 35,675,022 (GRCm39) missense probably damaging 1.00
RF020:Vps13b UTSW 15 35,925,552 (GRCm39) missense probably null 1.00
X0026:Vps13b UTSW 15 35,910,792 (GRCm39) missense probably damaging 1.00
X0028:Vps13b UTSW 15 35,709,577 (GRCm39) missense probably benign 0.00
Z1177:Vps13b UTSW 15 35,669,031 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGAAGCCTGTTATCGTTCTGC -3'
(R):5'- AAAAGCAGTCCTGTGGATGTTTATG -3'

Sequencing Primer
(F):5'- CTGCCCTTTAGATGGTCAGG -3'
(R):5'- ATGTTTATGGAGAGCTATATGCCATG -3'
Posted On 2019-05-15