Mutagenetix > Incidental Mutation

Incidental Mutation 'R7092:Ptk2'

550319

Institutional Source

Beutler Lab

Gene Symbol

Ptk2

Ensembl Gene

ENSMUSG00000022607

Gene Name

PTK2 protein tyrosine kinase 2

Synonyms

FRNK, FAK, Fadk

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7092 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

73205102-73423280 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 73221809 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 854 (P854S)

Ref Sequence

ENSEMBL: ENSMUSP00000105663 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110036] [ENSMUST00000226988]

AlphaFold

P34152

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110036
AA Change: P854S

PolyPhen 2 Score 0.459 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000105663
Gene: ENSMUSG00000022607
AA Change: P854S

Domain	Start	End	E-Value	Type
B41	31	258	1.49e-39	SMART
Blast:B41	288	333	1e-19	BLAST
TyrKc	422	676	1.11e-130	SMART
low complexity region	686	698	N/A	INTRINSIC
low complexity region	712	726	N/A	INTRINSIC
low complexity region	863	883	N/A	INTRINSIC
Pfam:Focal_AT	914	1046	5e-59	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000226988
AA Change: P854S

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)

Meta Mutation Damage Score

0.0739

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

99% (88/89)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein tyrosine kinase which is found concentrated in the focal adhesions that form between cells growing in the presence of extracellular matrix constituents. The encoded protein is a member of the FAK subfamily of protein tyrosine kinases but lacks significant sequence similarity to kinases from other subfamilies. Activation of this gene may be an important early step in cell growth and intracellular signal transduction pathways triggered in response to certain neural peptides or to cell interactions with the extracellular matrix. Several transcript variants encoding different isoforms have been found for this gene, but the full-length natures of only four of them have been determined. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele die before or during organogenesis with growth retardation, abnormal embryonic and extra embryonic tissue development, and abnormal vascular development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1300017J02Rik	G	A	9: 103,281,043	S106L	possibly damaging	Het
1700034I23Rik	T	A	3: 40,902,374	D22V	possibly damaging	Het
4922502D21Rik	T	A	6: 129,323,000	T172S	probably benign	Het
4930579F01Rik	C	T	3: 138,183,745	C37Y	probably benign	Het
8430408G22Rik	C	A	6: 116,651,788	P31T	probably damaging	Het
A430005L14Rik	T	A	4: 153,960,994		probably null	Het
Abca4	C	G	3: 122,138,569	P1499A	probably damaging	Het
Adcy8	T	C	15: 64,871,770	N330D	possibly damaging	Het
Arfgef1	A	G	1: 10,153,676	Y1466H	probably damaging	Het
Asz1	A	C	6: 18,071,819		probably null	Het
Atad5	T	A	11: 80,120,720	N1307K	possibly damaging	Het
B4galnt4	C	A	7: 141,068,636	F688L	probably damaging	Het
Birc6	C	T	17: 74,646,745	T3349I	probably damaging	Het
Ccp110	C	A	7: 118,735,271	A989E	probably benign	Het
Ccser2	A	G	14: 36,940,655	S191P	probably benign	Het
Cdca2	A	G	14: 67,707,351		probably null	Het
Cdcp1	T	A	9: 123,183,613	T290S	probably benign	Het
Cnnm1	T	C	19: 43,441,948	Y502H	probably damaging	Het
Cyba	T	G	8: 122,427,698	T29P	probably damaging	Het
Dcaf12	A	T	4: 41,301,366	I190N	probably damaging	Het
Epha1	T	C	6: 42,364,245	T512A	probably benign	Het
Fancg	G	A	4: 43,004,831	P454L	probably benign	Het
Fasn	A	C	11: 120,820,120	V268G	possibly damaging	Het
Fgfr1op	C	T	17: 8,172,970	P161S	probably benign	Het
Fip1l1	T	A	5: 74,536,843	L42Q	probably damaging	Het
Fjx1	A	G	2: 102,450,756	L278P	possibly damaging	Het
Fsd1	G	A	17: 55,993,876	R245H	probably damaging	Het
Gm1527	T	A	3: 28,914,547		probably null	Het
Gm8298	T	C	3: 59,861,079	F10S	probably benign	Het
Gng3	T	A	19: 8,838,247	M42L	probably benign	Het
Gsdmc2	T	A	15: 63,825,098	Q408L	probably damaging	Het
Gtpbp3	T	A	8: 71,492,265	I388K	probably benign	Het
Hmcn1	A	T	1: 150,604,246	W4534R	probably damaging	Het
Ist1	A	T	8: 109,682,596		probably null	Het
Kif1bp	C	A	10: 62,578,300	K26N	probably damaging	Het
Kyat3	T	C	3: 142,729,795	I276T	probably damaging	Het
Lipm	C	T	19: 34,121,358	P411S	possibly damaging	Het
Lipo3	T	C	19: 33,613,692		probably null	Het
Lrrc9	C	A	12: 72,463,464	Q446K	possibly damaging	Het
Mfsd4a	G	T	1: 132,067,663	T77N	probably benign	Het
Mmp1b	T	A	9: 7,386,981	D77V	probably damaging	Het
Mrgprb4	A	G	7: 48,198,236	S315P	probably benign	Het
Mroh2b	C	A	15: 4,934,678	N887K	possibly damaging	Het
Mto1	A	G	9: 78,470,673	K599R	probably benign	Het
Muc5ac	G	C	7: 141,809,687		probably benign	Het
Muc5ac	T	C	7: 141,809,648		probably benign	Het
Mylk2	A	G	2: 152,915,190	N295S	probably benign	Het
Nr1i3	G	A	1: 171,214,178		probably null	Het
Nup107	T	C	10: 117,790,494	K25E	probably damaging	Het
Odc1	G	A	12: 17,548,313	V152I	possibly damaging	Het
Olfr1022	A	T	2: 85,868,607	N5I	probably damaging	Het
Olfr364-ps1	T	A	2: 37,146,611	M133K	probably damaging	Het
Olfr53	G	A	7: 140,652,237	G86D	probably benign	Het
Olfr828	G	A	9: 18,816,057	P79L	probably damaging	Het
Pde1b	G	T	15: 103,527,031	V438L	probably benign	Het
Pde4b	G	A	4: 102,601,851	V523M	probably damaging	Het
Pdgfc	C	T	3: 81,204,352	P205S	probably damaging	Het
Per2	A	G	1: 91,421,431	S1073P	probably damaging	Het
Plekhg5	C	T	4: 152,114,508	T1051I	probably damaging	Het
Ppme1	A	T	7: 100,371,822	M1K	probably null	Het
Prokr2	A	T	2: 132,381,316	V102D	possibly damaging	Het
Ptprh	C	A	7: 4,580,861		probably null	Het
Rbsn	T	C	6: 92,189,626	N679S	probably damaging	Het
Rce1	T	C	19: 4,623,090	T303A	probably damaging	Het
Rnf123	C	A	9: 108,068,600	R329L	probably benign	Het
Robo2	T	A	16: 73,956,643	N782I	probably damaging	Het
Ror2	A	C	13: 53,110,236	V940G	probably benign	Het
Rpe65	C	T	3: 159,615,591	R347C	probably damaging	Het
Rrp8	A	T	7: 105,734,109	F317I	probably damaging	Het
Sidt1	A	G	16: 44,299,829	V163A	possibly damaging	Het
Sin3b	T	C	8: 72,747,870		probably null	Het
Slamf1	A	G	1: 171,777,189	T176A	probably benign	Het
Slc12a4	G	T	8: 105,945,223	A922D	probably damaging	Het
Slco1a5	T	A	6: 142,248,675	Q414L	probably benign	Het
Snx11	C	A	11: 96,772,839	R58L	probably damaging	Het
Sp9	A	G	2: 73,273,771	D223G	probably damaging	Het
Sptbn1	T	C	11: 30,137,119	I1107V	possibly damaging	Het
Stap2	T	C	17: 56,002,954	R66G	probably benign	Het
Synrg	T	G	11: 84,008,857	F552V	possibly damaging	Het
Trim60	C	T	8: 65,001,048	R183H	probably benign	Het
Ttn	T	C	2: 76,903,416	D4505G	unknown	Het
Ubxn4	A	G	1: 128,252,222	I34M	probably benign	Het
Vac14	T	A	8: 110,715,496	M702K	probably damaging	Het
Vmn1r43	T	C	6: 89,869,903	I200M	probably benign	Het
Vmn2r108	T	A	17: 20,481,076	Y54F	probably benign	Het
Vps13b	T	C	15: 35,640,634	Y1382H	probably damaging	Het
Wdr72	T	C	9: 74,210,472	I834T	probably damaging	Het
Zfp970	T	A	2: 177,475,292	C220S	probably damaging	Het
Zkscan5	T	G	5: 145,220,089	I467S	probably benign	Het

Other mutations in Ptk2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00861:Ptk2	APN	15	73262547	missense	probably damaging	1.00
IGL00913:Ptk2	APN	15	73295389	splice site	probably benign
IGL01605:Ptk2	APN	15	73264339	splice site	probably benign
IGL01631:Ptk2	APN	15	73216371	missense	probably damaging	1.00
IGL01952:Ptk2	APN	15	73229931	missense	probably damaging	0.99
IGL01957:Ptk2	APN	15	73242473	missense	probably benign	0.05
IGL02441:Ptk2	APN	15	73320826	missense	probably benign	0.16
IGL02471:Ptk2	APN	15	73298187	missense	probably benign	0.41
IGL02621:Ptk2	APN	15	73206145	missense	probably damaging	0.99
IGL03198:Ptk2	APN	15	73236216	missense	probably damaging	1.00
Shooter	UTSW	15	73304444	missense	possibly damaging	0.83
R0239:Ptk2	UTSW	15	73343283	splice site	probably null
R0239:Ptk2	UTSW	15	73343283	splice site	probably null
R1254:Ptk2	UTSW	15	73229970	missense	probably benign	0.01
R1291:Ptk2	UTSW	15	73210756	missense	probably damaging	1.00
R1307:Ptk2	UTSW	15	73292046	missense	probably benign	0.01
R1608:Ptk2	UTSW	15	73262575	missense	probably damaging	0.98
R1690:Ptk2	UTSW	15	73262610	missense	probably damaging	1.00
R1724:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R1725:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R1740:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R1741:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R1840:Ptk2	UTSW	15	73210884	missense	probably damaging	1.00
R1956:Ptk2	UTSW	15	73215983	missense	possibly damaging	0.49
R2022:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R2092:Ptk2	UTSW	15	73236191	nonsense	probably null
R2114:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R2115:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R2336:Ptk2	UTSW	15	73266116	missense	probably damaging	1.00
R2571:Ptk2	UTSW	15	73231919	missense	probably damaging	1.00
R4232:Ptk2	UTSW	15	73309849	missense	possibly damaging	0.61
R4245:Ptk2	UTSW	15	73231976	missense	probably benign	0.00
R4594:Ptk2	UTSW	15	73206196	missense	probably damaging	1.00
R4688:Ptk2	UTSW	15	73206225	missense	probably damaging	1.00
R4834:Ptk2	UTSW	15	73216096	splice site	probably null
R4847:Ptk2	UTSW	15	73231956	missense	probably benign
R5558:Ptk2	UTSW	15	73304445	missense	probably damaging	0.97
R5682:Ptk2	UTSW	15	73262564	nonsense	probably null
R5858:Ptk2	UTSW	15	73321095	missense	probably benign	0.12
R5951:Ptk2	UTSW	15	73303833	missense	possibly damaging	0.88
R6014:Ptk2	UTSW	15	73304444	missense	possibly damaging	0.83
R6027:Ptk2	UTSW	15	73229913	missense	probably damaging	1.00
R6082:Ptk2	UTSW	15	73276865	missense	probably damaging	1.00
R7025:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7031:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7032:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7077:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7078:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7079:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7090:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7091:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7136:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7137:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7798:Ptk2	UTSW	15	73295375	missense	probably damaging	1.00
R8057:Ptk2	UTSW	15	73298199	frame shift	probably null
R8235:Ptk2	UTSW	15	73343291	missense	probably benign	0.00
R9106:Ptk2	UTSW	15	73259608	missense	possibly damaging	0.95
R9160:Ptk2	UTSW	15	73216084	missense	probably benign	0.01
R9301:Ptk2	UTSW	15	73274497	missense	probably damaging	1.00
R9448:Ptk2	UTSW	15	73343192	missense	possibly damaging	0.78

Predicted Primers

PCR Primer
(F):5'- GGACAGTGATCTGCATCTATGAAAATC -3'
(R):5'- TTGGGAGCAGTGTCACAGTG -3'

Sequencing Primer
(F):5'- GCATCTATGAAAATCTGGAACATGGC -3'
(R):5'- ACACTGAGATGATGTTGGGTAC -3'

Posted On

2019-05-15