Incidental Mutation 'R7094:Clip1'
ID550348
Institutional Source Beutler Lab
Gene Symbol Clip1
Ensembl Gene ENSMUSG00000049550
Gene NameCAP-GLY domain containing linker protein 1
SynonymsClip50, 4631429H07Rik, CLIP-170, restin, Rsn, Clip 170, 1110007I12Rik, cytoplasmic linker protein 50
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7094 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location123577795-123684618 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123623270 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 734 (K734E)
Ref Sequence ENSEMBL: ENSMUSP00000107190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031382] [ENSMUST00000063905] [ENSMUST00000111561] [ENSMUST00000111564] [ENSMUST00000111566] [ENSMUST00000149410]
PDB Structure
Solution structure of the 1st CAP-Gly domain in mouse CLIP-170/restin [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000031382
AA Change: K856E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000031382
Gene: ENSMUSG00000049550
AA Change: K856E

DomainStartEndE-ValueType
internal_repeat_2 11 53 2.28e-5 PROSPERO
CAP_GLY 60 125 1.05e-31 SMART
internal_repeat_2 140 177 2.28e-5 PROSPERO
CAP_GLY 213 278 4.69e-34 SMART
low complexity region 286 304 N/A INTRINSIC
low complexity region 305 331 N/A INTRINSIC
coiled coil region 349 451 N/A INTRINSIC
coiled coil region 474 535 N/A INTRINSIC
coiled coil region 581 620 N/A INTRINSIC
coiled coil region 652 1352 N/A INTRINSIC
low complexity region 1362 1373 N/A INTRINSIC
Pfam:CLIP1_ZNF 1375 1392 5.8e-9 PFAM
ZnF_C2HC 1417 1433 1.45e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000063905
AA Change: K730E

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000068241
Gene: ENSMUSG00000049550
AA Change: K730E

DomainStartEndE-ValueType
internal_repeat_2 11 53 3.3e-5 PROSPERO
CAP_GLY 60 125 1.05e-31 SMART
internal_repeat_2 140 177 3.3e-5 PROSPERO
CAP_GLY 213 278 4.69e-34 SMART
low complexity region 286 304 N/A INTRINSIC
low complexity region 305 331 N/A INTRINSIC
coiled coil region 349 524 N/A INTRINSIC
coiled coil region 570 609 N/A INTRINSIC
coiled coil region 641 1075 N/A INTRINSIC
coiled coil region 1115 1235 N/A INTRINSIC
low complexity region 1245 1256 N/A INTRINSIC
ZnF_C2HC 1300 1316 1.45e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111561
AA Change: K845E

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000107186
Gene: ENSMUSG00000049550
AA Change: K845E

DomainStartEndE-ValueType
internal_repeat_2 11 53 1.93e-5 PROSPERO
CAP_GLY 60 125 1.05e-31 SMART
internal_repeat_2 140 177 1.93e-5 PROSPERO
CAP_GLY 213 278 4.69e-34 SMART
low complexity region 286 304 N/A INTRINSIC
low complexity region 305 331 N/A INTRINSIC
coiled coil region 349 524 N/A INTRINSIC
coiled coil region 570 609 N/A INTRINSIC
coiled coil region 641 1341 N/A INTRINSIC
low complexity region 1351 1362 N/A INTRINSIC
ZnF_C2HC 1406 1422 1.45e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111564
AA Change: K734E

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000107190
Gene: ENSMUSG00000049550
AA Change: K734E

DomainStartEndE-ValueType
internal_repeat_2 11 53 2.5e-5 PROSPERO
CAP_GLY 60 125 1.05e-31 SMART
internal_repeat_2 140 177 2.5e-5 PROSPERO
CAP_GLY 213 278 4.69e-34 SMART
low complexity region 286 304 N/A INTRINSIC
low complexity region 305 331 N/A INTRINSIC
coiled coil region 349 489 N/A INTRINSIC
coiled coil region 535 574 N/A INTRINSIC
coiled coil region 606 1230 N/A INTRINSIC
low complexity region 1240 1251 N/A INTRINSIC
ZnF_C2HC 1295 1311 1.45e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111566
AA Change: K810E

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000107192
Gene: ENSMUSG00000049550
AA Change: K810E

DomainStartEndE-ValueType
internal_repeat_2 11 53 2e-5 PROSPERO
CAP_GLY 60 125 1.05e-31 SMART
internal_repeat_2 140 177 2e-5 PROSPERO
CAP_GLY 213 278 4.69e-34 SMART
low complexity region 286 304 N/A INTRINSIC
low complexity region 305 331 N/A INTRINSIC
coiled coil region 349 489 N/A INTRINSIC
coiled coil region 535 574 N/A INTRINSIC
coiled coil region 606 1306 N/A INTRINSIC
low complexity region 1316 1327 N/A INTRINSIC
ZnF_C2HC 1371 1387 1.45e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000137363
AA Change: K482E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121425
Gene: ENSMUSG00000049550
AA Change: K482E

DomainStartEndE-ValueType
CAP_GLY 2 31 2.59e0 SMART
low complexity region 39 57 N/A INTRINSIC
low complexity region 58 84 N/A INTRINSIC
coiled coil region 101 276 N/A INTRINSIC
coiled coil region 322 361 N/A INTRINSIC
coiled coil region 393 980 N/A INTRINSIC
low complexity region 991 1002 N/A INTRINSIC
Pfam:CLIP1_ZNF 1004 1021 4.2e-9 PFAM
ZnF_C2HC 1046 1062 1.45e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144121
SMART Domains Protein: ENSMUSP00000119641
Gene: ENSMUSG00000049550

DomainStartEndE-ValueType
CAP_GLY 37 102 1.05e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149410
AA Change: K703E

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000115965
Gene: ENSMUSG00000049550
AA Change: K703E

DomainStartEndE-ValueType
low complexity region 26 32 N/A INTRINSIC
CAP_GLY 60 125 1.05e-31 SMART
CAP_GLY 213 278 4.69e-34 SMART
low complexity region 286 304 N/A INTRINSIC
low complexity region 305 331 N/A INTRINSIC
coiled coil region 334 458 N/A INTRINSIC
coiled coil region 504 543 N/A INTRINSIC
coiled coil region 575 827 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene links endocytic vesicles to microtubules. This gene is highly expressed in Reed-Sternberg cells of Hodgkin disease. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a targeted allele display reduced male fertility and teratozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,298,610 I2786F probably damaging Het
Actl6a A T 3: 32,706,338 probably benign Het
Actn2 A G 13: 12,309,657 V100A probably damaging Het
Arfgef3 G T 10: 18,646,439 A613E probably damaging Het
Atf6b G A 17: 34,653,816 probably null Het
BC048403 A G 10: 121,740,193 Y73C possibly damaging Het
Bub1 T A 2: 127,821,761 E240V probably null Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C530008M17Rik C T 5: 76,859,032 P1080L unknown Het
Ccdc141 C A 2: 77,041,453 R829L possibly damaging Het
Ccdc85c GCCGCCGCCGCCAGCGCCCCCCGCCGCCGCCAGCGCC GCCGCCGCCGCCAGCGCC 12: 108,274,618 probably null Het
Cd209g T C 8: 4,136,790 F112L possibly damaging Het
Cebpe C T 14: 54,710,603 R261H probably damaging Het
Cfap100 T C 6: 90,413,454 E68G Het
Chd9 A G 8: 90,989,561 N921S unknown Het
Chil6 T C 3: 106,404,170 N98S probably damaging Het
Cyp11b2 A G 15: 74,853,658 F204S possibly damaging Het
Dnah5 A G 15: 28,453,336 T4418A probably damaging Het
Dysf T C 6: 84,100,202 V649A probably benign Het
Ergic3 G A 2: 156,016,763 V270M possibly damaging Het
Eva1a C T 6: 82,092,043 T117I probably damaging Het
Fat4 G A 3: 38,889,874 G972D probably damaging Het
Gm14412 A T 2: 177,317,345 N39K probably damaging Het
Gm5565 T C 5: 146,158,274 T221A probably benign Het
Gnptab T G 10: 88,379,504 V29G possibly damaging Het
Grem2 T C 1: 174,836,989 Y98C probably damaging Het
Grik2 A T 10: 49,355,916 I506N possibly damaging Het
Has2 T A 15: 56,681,621 Y195F probably damaging Het
Lars2 T C 9: 123,459,585 L832P probably damaging Het
Lipo5 T A 19: 33,468,849 E49D probably damaging Het
Macc1 T A 12: 119,450,391 Y767* probably null Het
Map2 G T 1: 66,412,727 E259* probably null Het
Mcm9 T C 10: 53,620,157 D310G probably damaging Het
Mink1 C A 11: 70,610,075 probably null Het
Mtrr T C 13: 68,579,684 T48A possibly damaging Het
Nrsn1 A T 13: 25,253,741 I68N possibly damaging Het
Olfr1083-ps T C 2: 86,607,328 N81S unknown Het
Olfr1243 A T 2: 89,527,558 I284K probably damaging Het
Olfr374 A T 8: 72,109,503 probably benign Het
Olfr484 G T 7: 108,124,633 T210N probably benign Het
Olfr560 A G 7: 102,753,098 M277T probably benign Het
Pcdh17 A G 14: 84,447,395 D434G probably damaging Het
Rnf213 T A 11: 119,437,604 probably null Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Sez6l2 A G 7: 126,952,924 E121G probably damaging Het
Slc35e4 T C 11: 3,913,118 S24G probably benign Het
Slc39a2 G T 14: 51,893,689 probably benign Het
Slitrk5 C T 14: 111,680,836 P631S probably benign Het
Taf2 A G 15: 55,060,086 V265A probably benign Het
Tas2r106 T C 6: 131,678,579 N103S probably benign Het
Tgm1 T C 14: 55,704,843 T684A possibly damaging Het
Tgm7 C T 2: 121,099,008 G262S probably damaging Het
Tpp2 T A 1: 43,968,988 S451T probably damaging Het
Trim15 T C 17: 36,862,896 Y240C probably benign Het
Trio A T 15: 27,891,448 C465S unknown Het
Ttc22 G A 4: 106,635,907 W250* probably null Het
Upb1 C A 10: 75,438,208 F356L probably damaging Het
Vmn2r99 T A 17: 19,379,311 M419K probably benign Het
Vstm2a G A 11: 16,257,990 probably benign Het
Zfp820 T C 17: 21,819,265 T361A probably benign Het
Other mutations in Clip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Clip1 APN 5 123603654 missense possibly damaging 0.94
IGL01067:Clip1 APN 5 123630804 missense probably damaging 0.99
IGL01524:Clip1 APN 5 123579379 missense probably damaging 1.00
IGL01632:Clip1 APN 5 123617496 missense probably damaging 1.00
IGL01798:Clip1 APN 5 123583549 missense probably damaging 1.00
IGL01874:Clip1 APN 5 123603666 missense possibly damaging 0.50
IGL01908:Clip1 APN 5 123623207 splice site probably benign
IGL02120:Clip1 APN 5 123647883 missense probably damaging 1.00
IGL02309:Clip1 APN 5 123617700 missense probably damaging 0.99
IGL02555:Clip1 APN 5 123621794 critical splice donor site probably null
IGL03027:Clip1 APN 5 123621856 missense probably benign 0.43
IGL03336:Clip1 APN 5 123653570 nonsense probably null
IGL03365:Clip1 APN 5 123583586 missense probably damaging 1.00
IGL02802:Clip1 UTSW 5 123631123 missense probably damaging 1.00
PIT4812001:Clip1 UTSW 5 123630675 missense probably benign 0.08
R0254:Clip1 UTSW 5 123617332 splice site probably benign
R0401:Clip1 UTSW 5 123653789 missense probably damaging 1.00
R0530:Clip1 UTSW 5 123640531 missense probably damaging 1.00
R0744:Clip1 UTSW 5 123630721 missense probably benign 0.05
R0833:Clip1 UTSW 5 123630721 missense probably benign 0.05
R1116:Clip1 UTSW 5 123579491 missense probably damaging 0.99
R1182:Clip1 UTSW 5 123647865 missense probably damaging 1.00
R1656:Clip1 UTSW 5 123630403 missense possibly damaging 0.61
R1700:Clip1 UTSW 5 123630370 missense probably benign
R1889:Clip1 UTSW 5 123653496 missense probably damaging 0.99
R1975:Clip1 UTSW 5 123623218 missense possibly damaging 0.79
R2406:Clip1 UTSW 5 123603660 missense probably damaging 1.00
R3545:Clip1 UTSW 5 123631078 missense probably damaging 1.00
R3547:Clip1 UTSW 5 123631078 missense probably damaging 1.00
R3548:Clip1 UTSW 5 123631078 missense probably damaging 1.00
R3911:Clip1 UTSW 5 123590834 missense probably damaging 1.00
R3944:Clip1 UTSW 5 123617829 unclassified probably benign
R4660:Clip1 UTSW 5 123579374 missense probably damaging 0.98
R4784:Clip1 UTSW 5 123579293 missense probably damaging 1.00
R4785:Clip1 UTSW 5 123579293 missense probably damaging 1.00
R4824:Clip1 UTSW 5 123631023 missense probably damaging 1.00
R4831:Clip1 UTSW 5 123583601 missense probably damaging 1.00
R4951:Clip1 UTSW 5 123630345 missense probably benign 0.02
R4960:Clip1 UTSW 5 123654003 nonsense probably null
R5014:Clip1 UTSW 5 123617730 missense probably damaging 0.99
R5116:Clip1 UTSW 5 123630707 missense probably benign 0.05
R5212:Clip1 UTSW 5 123630681 missense probably benign 0.09
R5238:Clip1 UTSW 5 123647883 missense probably damaging 1.00
R5318:Clip1 UTSW 5 123613084 unclassified probably benign
R5372:Clip1 UTSW 5 123630240 missense probably benign 0.02
R5701:Clip1 UTSW 5 123613303 unclassified probably benign
R5734:Clip1 UTSW 5 123615154 unclassified probably benign
R5757:Clip1 UTSW 5 123627397 missense probably benign 0.21
R6024:Clip1 UTSW 5 123615089 missense possibly damaging 0.66
R6160:Clip1 UTSW 5 123613541 missense possibly damaging 0.66
R6177:Clip1 UTSW 5 123613834 unclassified probably benign
R6183:Clip1 UTSW 5 123642604 missense probably damaging 1.00
R6377:Clip1 UTSW 5 123603654 missense possibly damaging 0.50
R6436:Clip1 UTSW 5 123641785 missense probably damaging 1.00
R6471:Clip1 UTSW 5 123640549 missense probably damaging 0.99
R6766:Clip1 UTSW 5 123614764 unclassified probably benign
R7015:Clip1 UTSW 5 123613612 unclassified probably benign
R7143:Clip1 UTSW 5 123653610 missense probably benign
R7222:Clip1 UTSW 5 123611841 missense probably damaging 0.99
R7233:Clip1 UTSW 5 123611859 missense probably damaging 1.00
R7238:Clip1 UTSW 5 123613265 missense
R7249:Clip1 UTSW 5 123603600 missense probably damaging 1.00
R7283:Clip1 UTSW 5 123613794 missense
R7295:Clip1 UTSW 5 123627356 missense probably benign 0.19
R7447:Clip1 UTSW 5 123653633 missense probably benign 0.03
R7458:Clip1 UTSW 5 123640546 missense probably damaging 1.00
R7483:Clip1 UTSW 5 123617384 missense probably benign 0.00
R7516:Clip1 UTSW 5 123583385 missense probably benign 0.00
R7619:Clip1 UTSW 5 123614279 missense
R7831:Clip1 UTSW 5 123613279 missense
R7897:Clip1 UTSW 5 123622798 missense probably benign
R7914:Clip1 UTSW 5 123613279 missense
R7980:Clip1 UTSW 5 123622798 missense probably benign
Z1177:Clip1 UTSW 5 123617350 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTCAGGAAACCAATGGAATGCG -3'
(R):5'- GCCTGGATGTACAATTGGGTAC -3'

Sequencing Primer
(F):5'- GGAAACCAATGGAATGCGGTTTTTC -3'
(R):5'- TGGGTACAGATATACATGCACAC -3'
Posted On2019-05-15