Incidental Mutation 'R7094:Arfgef3'
ID 550362
Institutional Source Beutler Lab
Gene Symbol Arfgef3
Ensembl Gene ENSMUSG00000019852
Gene Name ARFGEF family member 3
Synonyms B930094H20Rik, D10Bwg1379e, BIG3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock # R7094 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 18581839-18743949 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 18646439 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Glutamic Acid at position 613 (A613E)
Ref Sequence ENSEMBL: ENSMUSP00000149210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019999] [ENSMUST00000215836]
AlphaFold Q3UGY8
Predicted Effect probably damaging
Transcript: ENSMUST00000019999
AA Change: A613E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000019999
Gene: ENSMUSG00000019852
AA Change: A613E

DomainStartEndE-ValueType
Pfam:DCB 1 170 7.1e-15 PFAM
low complexity region 236 245 N/A INTRINSIC
low complexity region 276 295 N/A INTRINSIC
low complexity region 452 462 N/A INTRINSIC
Sec7 582 794 6e-54 SMART
Blast:Sec7 798 873 3e-20 BLAST
low complexity region 927 940 N/A INTRINSIC
Pfam:DUF1981 1237 1312 1.9e-14 PFAM
low complexity region 1641 1652 N/A INTRINSIC
low complexity region 1710 1723 N/A INTRINSIC
low complexity region 1838 1856 N/A INTRINSIC
low complexity region 2088 2099 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215836
AA Change: A613E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (59/61)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased insulin granule biogenesis and insulin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,298,610 I2786F probably damaging Het
Actl6a A T 3: 32,706,338 probably benign Het
Actn2 A G 13: 12,309,657 V100A probably damaging Het
Atf6b G A 17: 34,653,816 probably null Het
BC048403 A G 10: 121,740,193 Y73C possibly damaging Het
Bub1 T A 2: 127,821,761 E240V probably null Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C530008M17Rik C T 5: 76,859,032 P1080L unknown Het
Ccdc141 C A 2: 77,041,453 R829L possibly damaging Het
Ccdc85c GCCGCCGCCGCCAGCGCCCCCCGCCGCCGCCAGCGCC GCCGCCGCCGCCAGCGCC 12: 108,274,618 probably null Het
Cd209g T C 8: 4,136,790 F112L possibly damaging Het
Cebpe C T 14: 54,710,603 R261H probably damaging Het
Cfap100 T C 6: 90,413,454 E68G Het
Chd9 A G 8: 90,989,561 N921S unknown Het
Chil6 T C 3: 106,404,170 N98S probably damaging Het
Clip1 T C 5: 123,623,270 K734E probably benign Het
Cyp11b2 A G 15: 74,853,658 F204S possibly damaging Het
Dnah5 A G 15: 28,453,336 T4418A probably damaging Het
Dysf T C 6: 84,100,202 V649A probably benign Het
Ergic3 G A 2: 156,016,763 V270M possibly damaging Het
Eva1a C T 6: 82,092,043 T117I probably damaging Het
Fat4 G A 3: 38,889,874 G972D probably damaging Het
Gm14412 A T 2: 177,317,345 N39K probably damaging Het
Gm5565 T C 5: 146,158,274 T221A probably benign Het
Gnptab T G 10: 88,379,504 V29G possibly damaging Het
Grem2 T C 1: 174,836,989 Y98C probably damaging Het
Grik2 A T 10: 49,355,916 I506N possibly damaging Het
Has2 T A 15: 56,681,621 Y195F probably damaging Het
Lars2 T C 9: 123,459,585 L832P probably damaging Het
Lipo5 T A 19: 33,468,849 E49D probably damaging Het
Macc1 T A 12: 119,450,391 Y767* probably null Het
Map2 G T 1: 66,412,727 E259* probably null Het
Mcm9 T C 10: 53,620,157 D310G probably damaging Het
Mink1 C A 11: 70,610,075 probably null Het
Mtrr T C 13: 68,579,684 T48A possibly damaging Het
Nrsn1 A T 13: 25,253,741 I68N possibly damaging Het
Olfr1083-ps T C 2: 86,607,328 N81S unknown Het
Olfr1243 A T 2: 89,527,558 I284K probably damaging Het
Olfr374 A T 8: 72,109,503 probably benign Het
Olfr484 G T 7: 108,124,633 T210N probably benign Het
Olfr560 A G 7: 102,753,098 M277T probably benign Het
Pcdh17 A G 14: 84,447,395 D434G probably damaging Het
Rnf213 T A 11: 119,437,604 probably null Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Sez6l2 A G 7: 126,952,924 E121G probably damaging Het
Slc35e4 T C 11: 3,913,118 S24G probably benign Het
Slc39a2 G T 14: 51,893,689 probably benign Het
Slitrk5 C T 14: 111,680,836 P631S probably benign Het
Taf2 A G 15: 55,060,086 V265A probably benign Het
Tas2r106 T C 6: 131,678,579 N103S probably benign Het
Tgm1 T C 14: 55,704,843 T684A possibly damaging Het
Tgm7 C T 2: 121,099,008 G262S probably damaging Het
Tpp2 T A 1: 43,968,988 S451T probably damaging Het
Trim15 T C 17: 36,862,896 Y240C probably benign Het
Trio A T 15: 27,891,448 C465S unknown Het
Ttc22 G A 4: 106,635,907 W250* probably null Het
Upb1 C A 10: 75,438,208 F356L probably damaging Het
Vmn2r99 T A 17: 19,379,311 M419K probably benign Het
Vstm2a G A 11: 16,257,990 probably benign Het
Zfp820 T C 17: 21,819,265 T361A probably benign Het
Other mutations in Arfgef3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:Arfgef3 APN 10 18660604 missense probably benign 0.03
IGL00835:Arfgef3 APN 10 18661358 missense probably benign
IGL00961:Arfgef3 APN 10 18611237 missense probably damaging 1.00
IGL01400:Arfgef3 APN 10 18652706 missense probably damaging 1.00
IGL01501:Arfgef3 APN 10 18600560 missense possibly damaging 0.93
IGL01595:Arfgef3 APN 10 18594912 missense possibly damaging 0.93
IGL01695:Arfgef3 APN 10 18603419 missense probably benign 0.00
IGL01774:Arfgef3 APN 10 18743615 missense possibly damaging 0.94
IGL02348:Arfgef3 APN 10 18591347 missense probably benign 0.04
IGL02371:Arfgef3 APN 10 18646539 missense probably benign
IGL02400:Arfgef3 APN 10 18646257 missense probably damaging 1.00
IGL02630:Arfgef3 APN 10 18661392 splice site probably benign
IGL02815:Arfgef3 APN 10 18652551 missense probably damaging 1.00
IGL03178:Arfgef3 APN 10 18613225 missense probably damaging 1.00
IGL03182:Arfgef3 APN 10 18600544 missense probably damaging 1.00
IGL03267:Arfgef3 APN 10 18591882 missense probably damaging 1.00
IGL03294:Arfgef3 APN 10 18664912 missense probably damaging 0.97
IGL03410:Arfgef3 APN 10 18600490 missense probably damaging 1.00
Bow-wow UTSW 10 18646730 nonsense probably null
R0098:Arfgef3 UTSW 10 18589642 missense probably damaging 1.00
R0098:Arfgef3 UTSW 10 18589642 missense probably damaging 1.00
R0141:Arfgef3 UTSW 10 18597407 missense probably damaging 1.00
R0164:Arfgef3 UTSW 10 18647915 missense possibly damaging 0.77
R0164:Arfgef3 UTSW 10 18647915 missense possibly damaging 0.77
R0241:Arfgef3 UTSW 10 18599214 missense probably damaging 1.00
R0334:Arfgef3 UTSW 10 18592281 missense probably damaging 0.98
R0352:Arfgef3 UTSW 10 18661387 missense probably benign 0.17
R0415:Arfgef3 UTSW 10 18613127 splice site probably benign
R0417:Arfgef3 UTSW 10 18603511 missense probably damaging 1.00
R0442:Arfgef3 UTSW 10 18677815 splice site probably benign
R0507:Arfgef3 UTSW 10 18591621 missense probably damaging 1.00
R0573:Arfgef3 UTSW 10 18599288 missense probably damaging 1.00
R0582:Arfgef3 UTSW 10 18611290 missense probably damaging 1.00
R0609:Arfgef3 UTSW 10 18597431 missense probably benign 0.31
R0826:Arfgef3 UTSW 10 18589666 missense probably damaging 0.98
R0919:Arfgef3 UTSW 10 18589735 missense possibly damaging 0.89
R0980:Arfgef3 UTSW 10 18592118 missense possibly damaging 0.82
R1027:Arfgef3 UTSW 10 18591375 missense probably benign 0.02
R1140:Arfgef3 UTSW 10 18597348 missense possibly damaging 0.77
R1491:Arfgef3 UTSW 10 18646554 missense probably damaging 1.00
R1493:Arfgef3 UTSW 10 18630879 missense probably damaging 0.96
R1529:Arfgef3 UTSW 10 18613222 nonsense probably null
R1564:Arfgef3 UTSW 10 18591704 missense probably damaging 1.00
R1654:Arfgef3 UTSW 10 18625148 missense probably null 0.15
R1868:Arfgef3 UTSW 10 18661387 missense probably benign 0.17
R1876:Arfgef3 UTSW 10 18597356 missense probably damaging 1.00
R1908:Arfgef3 UTSW 10 18652763 missense possibly damaging 0.80
R2211:Arfgef3 UTSW 10 18592245 missense possibly damaging 0.54
R2316:Arfgef3 UTSW 10 18616953 missense probably benign 0.19
R2393:Arfgef3 UTSW 10 18597787 missense possibly damaging 0.88
R2407:Arfgef3 UTSW 10 18677866 missense possibly damaging 0.63
R3076:Arfgef3 UTSW 10 18603530 missense probably damaging 0.99
R3077:Arfgef3 UTSW 10 18603530 missense probably damaging 0.99
R3963:Arfgef3 UTSW 10 18592277 missense probably damaging 1.00
R4201:Arfgef3 UTSW 10 18619782 missense probably benign 0.01
R4241:Arfgef3 UTSW 10 18625164 missense probably damaging 1.00
R4244:Arfgef3 UTSW 10 18630420 missense probably damaging 1.00
R4395:Arfgef3 UTSW 10 18597709 missense probably damaging 1.00
R4455:Arfgef3 UTSW 10 18607675 missense probably benign 0.18
R4480:Arfgef3 UTSW 10 18600600 missense probably damaging 1.00
R4499:Arfgef3 UTSW 10 18608343 missense possibly damaging 0.95
R4589:Arfgef3 UTSW 10 18646199 missense probably damaging 1.00
R4635:Arfgef3 UTSW 10 18634855 missense probably damaging 1.00
R4776:Arfgef3 UTSW 10 18654247 missense probably benign
R4801:Arfgef3 UTSW 10 18591906 missense probably benign 0.00
R4802:Arfgef3 UTSW 10 18591906 missense probably benign 0.00
R4807:Arfgef3 UTSW 10 18646637 missense probably benign
R4828:Arfgef3 UTSW 10 18652693 missense probably damaging 0.99
R4861:Arfgef3 UTSW 10 18607731 missense probably benign 0.01
R4861:Arfgef3 UTSW 10 18607731 missense probably benign 0.01
R4917:Arfgef3 UTSW 10 18616890 missense probably damaging 0.99
R4918:Arfgef3 UTSW 10 18616890 missense probably damaging 0.99
R4922:Arfgef3 UTSW 10 18592186 missense probably damaging 0.97
R4929:Arfgef3 UTSW 10 18630851 missense probably benign 0.00
R4937:Arfgef3 UTSW 10 18589706 missense probably damaging 0.98
R5290:Arfgef3 UTSW 10 18600460 missense probably damaging 1.00
R5410:Arfgef3 UTSW 10 18611237 missense probably damaging 0.99
R5807:Arfgef3 UTSW 10 18647798 splice site probably null
R5832:Arfgef3 UTSW 10 18630420 missense probably damaging 1.00
R5887:Arfgef3 UTSW 10 18607665 nonsense probably null
R6272:Arfgef3 UTSW 10 18646963 missense probably benign 0.00
R6302:Arfgef3 UTSW 10 18652841 missense probably damaging 0.97
R6397:Arfgef3 UTSW 10 18607665 nonsense probably null
R6495:Arfgef3 UTSW 10 18611202 critical splice donor site probably null
R6707:Arfgef3 UTSW 10 18621155 missense probably benign 0.11
R6814:Arfgef3 UTSW 10 18595019 missense probably damaging 1.00
R6830:Arfgef3 UTSW 10 18664889 critical splice donor site probably null
R6870:Arfgef3 UTSW 10 18646730 nonsense probably null
R6941:Arfgef3 UTSW 10 18625455 missense possibly damaging 0.66
R7179:Arfgef3 UTSW 10 18599267 missense probably damaging 1.00
R7204:Arfgef3 UTSW 10 18646462 missense probably damaging 1.00
R7247:Arfgef3 UTSW 10 18625391 missense probably benign 0.00
R7249:Arfgef3 UTSW 10 18630835 missense possibly damaging 0.62
R7318:Arfgef3 UTSW 10 18630463 missense possibly damaging 0.89
R7391:Arfgef3 UTSW 10 18646259 missense probably benign 0.05
R7527:Arfgef3 UTSW 10 18646629 missense probably benign
R7618:Arfgef3 UTSW 10 18646281 missense probably damaging 1.00
R7779:Arfgef3 UTSW 10 18595023 missense probably damaging 0.99
R7851:Arfgef3 UTSW 10 18592286 missense probably damaging 1.00
R8112:Arfgef3 UTSW 10 18652631 missense possibly damaging 0.96
R8133:Arfgef3 UTSW 10 18611203 critical splice donor site probably null
R8242:Arfgef3 UTSW 10 18630076 missense probably benign 0.25
R8369:Arfgef3 UTSW 10 18589729 missense probably benign 0.34
R8396:Arfgef3 UTSW 10 18652532 critical splice donor site probably null
R8553:Arfgef3 UTSW 10 18603530 missense probably damaging 0.99
R8798:Arfgef3 UTSW 10 18647051 missense probably damaging 1.00
R8821:Arfgef3 UTSW 10 18652743 missense possibly damaging 0.95
R8831:Arfgef3 UTSW 10 18652743 missense possibly damaging 0.95
R8918:Arfgef3 UTSW 10 18635705 missense probably benign 0.01
R8929:Arfgef3 UTSW 10 18603455 missense probably damaging 1.00
R9001:Arfgef3 UTSW 10 18646728 missense probably benign 0.32
R9077:Arfgef3 UTSW 10 18625151 missense possibly damaging 0.81
R9258:Arfgef3 UTSW 10 18589639 missense probably damaging 1.00
R9267:Arfgef3 UTSW 10 18599280 missense probably damaging 1.00
R9358:Arfgef3 UTSW 10 18616880 missense probably damaging 1.00
R9388:Arfgef3 UTSW 10 18630129 missense probably benign 0.35
R9389:Arfgef3 UTSW 10 18603523 missense probably damaging 1.00
R9563:Arfgef3 UTSW 10 18646527 missense probably damaging 1.00
R9713:Arfgef3 UTSW 10 18652808 missense probably damaging 1.00
X0026:Arfgef3 UTSW 10 18652626 missense probably damaging 1.00
Z1176:Arfgef3 UTSW 10 18591437 missense probably damaging 1.00
Z1176:Arfgef3 UTSW 10 18608358 missense probably damaging 0.97
Z1176:Arfgef3 UTSW 10 18634852 missense probably benign 0.26
Z1177:Arfgef3 UTSW 10 18607776 missense probably damaging 1.00
Z1177:Arfgef3 UTSW 10 18627628 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATAAACAGTCGGGCGCTGTG -3'
(R):5'- CAGCCATTCAGGAAGGCAAG -3'

Sequencing Primer
(F):5'- GTGCTGGTCTGCCTCCTG -3'
(R):5'- CTATAGACCAGCCAGATGTGGTTC -3'
Posted On 2019-05-15