Incidental Mutation 'R7094:Slitrk5'
ID550381
Institutional Source Beutler Lab
Gene Symbol Slitrk5
Ensembl Gene ENSMUSG00000033214
Gene NameSLIT and NTRK-like family, member 5
Synonyms2610019D03Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_198865.1; MGI:2679448

Is this an essential gene? Possibly non essential (E-score: 0.451) question?
Stock #R7094 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location111675097-111683141 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 111680836 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 631 (P631S)
Ref Sequence ENSEMBL: ENSMUSP00000041499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042767] [ENSMUST00000227891]
Predicted Effect probably benign
Transcript: ENSMUST00000042767
AA Change: P631S

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000041499
Gene: ENSMUSG00000033214
AA Change: P631S

DomainStartEndE-ValueType
Blast:LRRNT 47 85 3e-18 BLAST
low complexity region 86 96 N/A INTRINSIC
LRR 108 127 2.76e2 SMART
LRR_TYP 128 151 1.67e-2 SMART
LRR 152 175 2.67e-1 SMART
LRR 176 199 1.08e-1 SMART
LRR 202 223 7.38e1 SMART
LRRCT 235 285 2.13e-5 SMART
low complexity region 308 323 N/A INTRINSIC
LRRNT 373 410 9.53e-2 SMART
LRR 433 455 1.45e1 SMART
LRR_TYP 456 479 4.94e-5 SMART
LRR_TYP 480 503 7.78e-3 SMART
LRR_TYP 504 527 2.43e-4 SMART
LRR 528 551 1.86e2 SMART
LRRCT 563 613 3.59e-3 SMART
low complexity region 618 632 N/A INTRINSIC
transmembrane domain 666 688 N/A INTRINSIC
low complexity region 794 816 N/A INTRINSIC
low complexity region 818 823 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000227891
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (59/61)
MGI Phenotype Strain: 4459459
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the SLITRK family, such as SLITRK5, are integral membrane proteins with 2 N-terminal leucine-rich repeat (LRR) domains similar to those of SLIT proteins (see SLIT1; MIM 603742). Most SLITRKs, including SLITRK5, also have C-terminal regions that share homology with neurotrophin receptors (see NTRK1; MIM 191315). SLITRKs are expressed predominantly in neural tissues and have neurite-modulating activity (Aruga et al., 2003 [PubMed 14557068]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele have abnormal medium spiny neuron morphology and exhibit behavioral abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,298,610 I2786F probably damaging Het
Actl6a A T 3: 32,706,338 probably benign Het
Actn2 A G 13: 12,309,657 V100A probably damaging Het
Arfgef3 G T 10: 18,646,439 A613E probably damaging Het
Atf6b G A 17: 34,653,816 probably null Het
BC048403 A G 10: 121,740,193 Y73C possibly damaging Het
Bub1 T A 2: 127,821,761 E240V probably null Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C530008M17Rik C T 5: 76,859,032 P1080L unknown Het
Ccdc141 C A 2: 77,041,453 R829L possibly damaging Het
Ccdc85c GCCGCCGCCGCCAGCGCCCCCCGCCGCCGCCAGCGCC GCCGCCGCCGCCAGCGCC 12: 108,274,618 probably null Het
Cd209g T C 8: 4,136,790 F112L possibly damaging Het
Cebpe C T 14: 54,710,603 R261H probably damaging Het
Cfap100 T C 6: 90,413,454 E68G Het
Chd9 A G 8: 90,989,561 N921S unknown Het
Chil6 T C 3: 106,404,170 N98S probably damaging Het
Clip1 T C 5: 123,623,270 K734E probably benign Het
Cyp11b2 A G 15: 74,853,658 F204S possibly damaging Het
Dnah5 A G 15: 28,453,336 T4418A probably damaging Het
Dysf T C 6: 84,100,202 V649A probably benign Het
Ergic3 G A 2: 156,016,763 V270M possibly damaging Het
Eva1a C T 6: 82,092,043 T117I probably damaging Het
Fat4 G A 3: 38,889,874 G972D probably damaging Het
Gm14412 A T 2: 177,317,345 N39K probably damaging Het
Gm5565 T C 5: 146,158,274 T221A probably benign Het
Gnptab T G 10: 88,379,504 V29G possibly damaging Het
Grem2 T C 1: 174,836,989 Y98C probably damaging Het
Grik2 A T 10: 49,355,916 I506N possibly damaging Het
Has2 T A 15: 56,681,621 Y195F probably damaging Het
Lars2 T C 9: 123,459,585 L832P probably damaging Het
Lipo5 T A 19: 33,468,849 E49D probably damaging Het
Macc1 T A 12: 119,450,391 Y767* probably null Het
Map2 G T 1: 66,412,727 E259* probably null Het
Mcm9 T C 10: 53,620,157 D310G probably damaging Het
Mink1 C A 11: 70,610,075 probably null Het
Mtrr T C 13: 68,579,684 T48A possibly damaging Het
Nrsn1 A T 13: 25,253,741 I68N possibly damaging Het
Olfr1083-ps T C 2: 86,607,328 N81S unknown Het
Olfr1243 A T 2: 89,527,558 I284K probably damaging Het
Olfr374 A T 8: 72,109,503 probably benign Het
Olfr484 G T 7: 108,124,633 T210N probably benign Het
Olfr560 A G 7: 102,753,098 M277T probably benign Het
Pcdh17 A G 14: 84,447,395 D434G probably damaging Het
Rnf213 T A 11: 119,437,604 probably null Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Sez6l2 A G 7: 126,952,924 E121G probably damaging Het
Slc35e4 T C 11: 3,913,118 S24G probably benign Het
Slc39a2 G T 14: 51,893,689 probably benign Het
Taf2 A G 15: 55,060,086 V265A probably benign Het
Tas2r106 T C 6: 131,678,579 N103S probably benign Het
Tgm1 T C 14: 55,704,843 T684A possibly damaging Het
Tgm7 C T 2: 121,099,008 G262S probably damaging Het
Tpp2 T A 1: 43,968,988 S451T probably damaging Het
Trim15 T C 17: 36,862,896 Y240C probably benign Het
Trio A T 15: 27,891,448 C465S unknown Het
Ttc22 G A 4: 106,635,907 W250* probably null Het
Upb1 C A 10: 75,438,208 F356L probably damaging Het
Vmn2r99 T A 17: 19,379,311 M419K probably benign Het
Vstm2a G A 11: 16,257,990 probably benign Het
Zfp820 T C 17: 21,819,265 T361A probably benign Het
Other mutations in Slitrk5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Slitrk5 APN 14 111680665 missense probably benign 0.05
IGL01624:Slitrk5 APN 14 111681094 missense probably damaging 1.00
IGL01680:Slitrk5 APN 14 111679000 missense probably benign 0.23
IGL03234:Slitrk5 APN 14 111679285 missense probably benign 0.00
P0019:Slitrk5 UTSW 14 111680594 missense possibly damaging 0.88
R0323:Slitrk5 UTSW 14 111681623 missense probably damaging 0.99
R0334:Slitrk5 UTSW 14 111680824 missense probably benign
R0392:Slitrk5 UTSW 14 111679033 missense probably benign 0.06
R0659:Slitrk5 UTSW 14 111680689 missense probably benign 0.00
R1344:Slitrk5 UTSW 14 111680389 missense probably benign 0.04
R1754:Slitrk5 UTSW 14 111680519 missense probably damaging 1.00
R1983:Slitrk5 UTSW 14 111680389 missense probably benign 0.04
R2070:Slitrk5 UTSW 14 111680189 missense probably damaging 0.99
R2071:Slitrk5 UTSW 14 111680189 missense probably damaging 0.99
R3001:Slitrk5 UTSW 14 111679582 missense probably damaging 1.00
R3002:Slitrk5 UTSW 14 111679582 missense probably damaging 1.00
R3003:Slitrk5 UTSW 14 111679582 missense probably damaging 1.00
R3885:Slitrk5 UTSW 14 111679797 nonsense probably null
R3886:Slitrk5 UTSW 14 111679797 nonsense probably null
R3888:Slitrk5 UTSW 14 111679797 nonsense probably null
R4962:Slitrk5 UTSW 14 111681247 missense probably benign 0.02
R4999:Slitrk5 UTSW 14 111680216 missense probably damaging 0.99
R5036:Slitrk5 UTSW 14 111680884 missense possibly damaging 0.87
R5190:Slitrk5 UTSW 14 111679420 missense probably damaging 1.00
R5237:Slitrk5 UTSW 14 111681686 missense possibly damaging 0.94
R5669:Slitrk5 UTSW 14 111681623 missense probably damaging 0.99
R5793:Slitrk5 UTSW 14 111679913 missense probably damaging 1.00
R5839:Slitrk5 UTSW 14 111679598 missense probably benign 0.00
R6083:Slitrk5 UTSW 14 111681725 missense probably benign 0.01
R6224:Slitrk5 UTSW 14 111679816 unclassified probably benign
R6225:Slitrk5 UTSW 14 111679816 unclassified probably benign
R6230:Slitrk5 UTSW 14 111679816 unclassified probably benign
R6337:Slitrk5 UTSW 14 111680252 missense probably damaging 0.96
R6666:Slitrk5 UTSW 14 111680102 missense probably damaging 0.96
R6818:Slitrk5 UTSW 14 111680294 missense probably benign 0.32
R6895:Slitrk5 UTSW 14 111681653 missense probably damaging 1.00
R7385:Slitrk5 UTSW 14 111680699 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- GATCTACATGACAACCCTTGGG -3'
(R):5'- CTCCGTTTCATGACCAGCAC -3'

Sequencing Primer
(F):5'- ATGACAACCCTTGGGATTGTACCTG -3'
(R):5'- ACGAAAAGGCCTGCTGC -3'
Posted On2019-05-15