Mutagenetix > Incidental Mutation

Incidental Mutation 'R7094:Taf2'

550384

Institutional Source

Beutler Lab

Gene Symbol

Taf2

Ensembl Gene

ENSMUSG00000037343

Gene Name

TATA-box binding protein associated factor 2

Synonyms

CIF150, 150kDa, TAF2B, 4732460C16Rik, TAFII150

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7094 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

55015131-55072152 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 55060086 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 265 (V265A)

Ref Sequence

ENSEMBL: ENSMUSP00000043733 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041733]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000041733
AA Change: V265A

PolyPhen 2 Score 0.268 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000043733
Gene: ENSMUSG00000037343
AA Change: V265A

Domain	Start	End	E-Value	Type
Pfam:Peptidase_M1	21	406	5.6e-17	PFAM
SCOP:d1gw5a_	606	973	6e-7	SMART
low complexity region	987	998	N/A	INTRINSIC
low complexity region	1142	1175	N/A	INTRINSIC

Meta Mutation Damage Score

0.2282

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

97% (59/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes one of the larger subunits of TFIID that is stably associated with the TFIID complex. It contributes to interactions at and downstream of the transcription initiation site, interactions that help determine transcription complex response to activators. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	A	T	11: 9,298,610	I2786F	probably damaging	Het
Actl6a	A	T	3: 32,706,338		probably benign	Het
Actn2	A	G	13: 12,309,657	V100A	probably damaging	Het
Arfgef3	G	T	10: 18,646,439	A613E	probably damaging	Het
Atf6b	G	A	17: 34,653,816		probably null	Het
BC048403	A	G	10: 121,740,193	Y73C	possibly damaging	Het
Bub1	T	A	2: 127,821,761	E240V	probably null	Het
C1ra	G	A	6: 124,517,725	E316K	probably benign	Het
C530008M17Rik	C	T	5: 76,859,032	P1080L	unknown	Het
Ccdc141	C	A	2: 77,041,453	R829L	possibly damaging	Het
Ccdc85c	GCCGCCGCCGCCAGCGCCCCCCGCCGCCGCCAGCGCC	GCCGCCGCCGCCAGCGCC	12: 108,274,618		probably null	Het
Cd209g	T	C	8: 4,136,790	F112L	possibly damaging	Het
Cebpe	C	T	14: 54,710,603	R261H	probably damaging	Het
Cfap100	T	C	6: 90,413,454	E68G		Het
Chd9	A	G	8: 90,989,561	N921S	unknown	Het
Chil6	T	C	3: 106,404,170	N98S	probably damaging	Het
Clip1	T	C	5: 123,623,270	K734E	probably benign	Het
Cyp11b2	A	G	15: 74,853,658	F204S	possibly damaging	Het
Dnah5	A	G	15: 28,453,336	T4418A	probably damaging	Het
Dysf	T	C	6: 84,100,202	V649A	probably benign	Het
Ergic3	G	A	2: 156,016,763	V270M	possibly damaging	Het
Eva1a	C	T	6: 82,092,043	T117I	probably damaging	Het
Fat4	G	A	3: 38,889,874	G972D	probably damaging	Het
Gm14412	A	T	2: 177,317,345	N39K	probably damaging	Het
Gm5565	T	C	5: 146,158,274	T221A	probably benign	Het
Gnptab	T	G	10: 88,379,504	V29G	possibly damaging	Het
Grem2	T	C	1: 174,836,989	Y98C	probably damaging	Het
Grik2	A	T	10: 49,355,916	I506N	possibly damaging	Het
Has2	T	A	15: 56,681,621	Y195F	probably damaging	Het
Lars2	T	C	9: 123,459,585	L832P	probably damaging	Het
Lipo5	T	A	19: 33,468,849	E49D	probably damaging	Het
Macc1	T	A	12: 119,450,391	Y767*	probably null	Het
Map2	G	T	1: 66,412,727	E259*	probably null	Het
Mcm9	T	C	10: 53,620,157	D310G	probably damaging	Het
Mink1	C	A	11: 70,610,075		probably null	Het
Mtrr	T	C	13: 68,579,684	T48A	possibly damaging	Het
Nrsn1	A	T	13: 25,253,741	I68N	possibly damaging	Het
Olfr1083-ps	T	C	2: 86,607,328	N81S	unknown	Het
Olfr1243	A	T	2: 89,527,558	I284K	probably damaging	Het
Olfr374	A	T	8: 72,109,503		probably benign	Het
Olfr484	G	T	7: 108,124,633	T210N	probably benign	Het
Olfr560	A	G	7: 102,753,098	M277T	probably benign	Het
Pcdh17	A	G	14: 84,447,395	D434G	probably damaging	Het
Rnf213	T	A	11: 119,437,604		probably null	Het
Selplg	GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT	GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT	5: 113,819,695		probably benign	Het
Sez6l2	A	G	7: 126,952,924	E121G	probably damaging	Het
Slc35e4	T	C	11: 3,913,118	S24G	probably benign	Het
Slc39a2	G	T	14: 51,893,689		probably benign	Het
Slitrk5	C	T	14: 111,680,836	P631S	probably benign	Het
Tas2r106	T	C	6: 131,678,579	N103S	probably benign	Het
Tgm1	T	C	14: 55,704,843	T684A	possibly damaging	Het
Tgm7	C	T	2: 121,099,008	G262S	probably damaging	Het
Tpp2	T	A	1: 43,968,988	S451T	probably damaging	Het
Trim15	T	C	17: 36,862,896	Y240C	probably benign	Het
Trio	A	T	15: 27,891,448	C465S	unknown	Het
Ttc22	G	A	4: 106,635,907	W250*	probably null	Het
Upb1	C	A	10: 75,438,208	F356L	probably damaging	Het
Vmn2r99	T	A	17: 19,379,311	M419K	probably benign	Het
Vstm2a	G	A	11: 16,257,990		probably benign	Het
Zfp820	T	C	17: 21,819,265	T361A	probably benign	Het

Other mutations in Taf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00331:Taf2	APN	15	55071449	critical splice acceptor site	probably null
IGL00475:Taf2	APN	15	55055850	nonsense	probably null
IGL00549:Taf2	APN	15	55031115	missense	probably benign	0.03
IGL00839:Taf2	APN	15	55045778	nonsense	probably null
IGL01089:Taf2	APN	15	55016581	missense	probably benign
IGL01305:Taf2	APN	15	55048274	missense	probably damaging	0.99
IGL01532:Taf2	APN	15	55049486	missense	possibly damaging	0.94
IGL01903:Taf2	APN	15	55060016	missense	probably benign	0.03
IGL02324:Taf2	APN	15	55028376	missense	probably benign
IGL02328:Taf2	APN	15	55028376	missense	probably benign
IGL02405:Taf2	APN	15	55034155	splice site	probably benign
IGL02671:Taf2	APN	15	55034176	missense	probably benign	0.01
IGL02832:Taf2	APN	15	55016563	missense	probably benign	0.01
IGL03105:Taf2	APN	15	55045799	missense	probably benign	0.26
IGL03118:Taf2	APN	15	55052163	missense	probably damaging	1.00
ANU22:Taf2	UTSW	15	55048274	missense	probably damaging	0.99
R0104:Taf2	UTSW	15	55038338	missense	probably benign	0.02
R0104:Taf2	UTSW	15	55038338	missense	probably benign	0.02
R0183:Taf2	UTSW	15	55055790	missense	possibly damaging	0.89
R0326:Taf2	UTSW	15	55047460	missense	probably damaging	0.97
R0362:Taf2	UTSW	15	55045929	missense	probably damaging	1.00
R0423:Taf2	UTSW	15	55064682	missense	probably benign	0.02
R0562:Taf2	UTSW	15	55022188	splice site	probably benign
R0609:Taf2	UTSW	15	55060050	missense	probably damaging	1.00
R0655:Taf2	UTSW	15	55038294	missense	probably damaging	1.00
R0689:Taf2	UTSW	15	55063065	missense	possibly damaging	0.60
R0743:Taf2	UTSW	15	55016461	small deletion	probably benign
R0898:Taf2	UTSW	15	55060084	missense	probably damaging	0.97
R0969:Taf2	UTSW	15	55031157	critical splice acceptor site	probably null
R0974:Taf2	UTSW	15	55016461	small deletion	probably benign
R1145:Taf2	UTSW	15	55016461	small deletion	probably benign
R1145:Taf2	UTSW	15	55016461	small deletion	probably benign
R1160:Taf2	UTSW	15	55071397	missense	probably benign	0.01
R1376:Taf2	UTSW	15	55016461	small deletion	probably benign
R1388:Taf2	UTSW	15	55036625	missense	probably benign	0.00
R1416:Taf2	UTSW	15	55038410	missense	possibly damaging	0.95
R1458:Taf2	UTSW	15	55059915	missense	probably damaging	0.99
R1477:Taf2	UTSW	15	55062172	missense	possibly damaging	0.87
R1755:Taf2	UTSW	15	55016454	missense	probably damaging	1.00
R1766:Taf2	UTSW	15	55071397	missense	probably benign	0.01
R2090:Taf2	UTSW	15	55016486	missense	probably damaging	0.99
R2228:Taf2	UTSW	15	55064646	missense	possibly damaging	0.94
R2519:Taf2	UTSW	15	55052247	missense	probably benign	0.03
R4073:Taf2	UTSW	15	55052237	missense	probably damaging	1.00
R4470:Taf2	UTSW	15	55058880	missense	possibly damaging	0.70
R4471:Taf2	UTSW	15	55058880	missense	possibly damaging	0.70
R4472:Taf2	UTSW	15	55058880	missense	possibly damaging	0.70
R4716:Taf2	UTSW	15	55065968	missense	probably benign	0.02
R4937:Taf2	UTSW	15	55027223	nonsense	probably null
R5082:Taf2	UTSW	15	55060045	missense	probably benign	0.41
R5335:Taf2	UTSW	15	55045740	missense	probably benign	0.14
R5383:Taf2	UTSW	15	55049419	missense	possibly damaging	0.78
R5771:Taf2	UTSW	15	55059939	missense	probably benign	0.01
R5862:Taf2	UTSW	15	55048323	missense	possibly damaging	0.95
R5873:Taf2	UTSW	15	55038422	missense	probably benign	0.00
R5908:Taf2	UTSW	15	55072006	unclassified	probably benign
R6033:Taf2	UTSW	15	55058901	missense	probably damaging	1.00
R6033:Taf2	UTSW	15	55058901	missense	probably damaging	1.00
R6159:Taf2	UTSW	15	55063044	missense	possibly damaging	0.48
R6568:Taf2	UTSW	15	55064630	missense	probably damaging	1.00
R7174:Taf2	UTSW	15	55048739	missense	possibly damaging	0.51
R7241:Taf2	UTSW	15	55062141	missense	probably benign	0.01
R7561:Taf2	UTSW	15	55055833	missense	probably benign	0.16
R7583:Taf2	UTSW	15	55064676	nonsense	probably null
R7818:Taf2	UTSW	15	55065930	missense	probably benign
R7905:Taf2	UTSW	15	55047432	missense	possibly damaging	0.90
R8006:Taf2	UTSW	15	55048701	missense	probably damaging	1.00
R8017:Taf2	UTSW	15	55064617	missense	possibly damaging	0.66
R8019:Taf2	UTSW	15	55064617	missense	possibly damaging	0.66
R8119:Taf2	UTSW	15	55031130	missense	probably benign	0.00
R8127:Taf2	UTSW	15	55059988	missense	probably damaging	1.00
R8128:Taf2	UTSW	15	55059988	missense	probably damaging	1.00
R8129:Taf2	UTSW	15	55059988	missense	probably damaging	1.00
R8278:Taf2	UTSW	15	55065965	nonsense	probably null
R8290:Taf2	UTSW	15	55063020	missense	probably damaging	1.00
R8762:Taf2	UTSW	15	55047453	missense	probably benign	0.16
R8832:Taf2	UTSW	15	55064605	missense	possibly damaging	0.86
R8916:Taf2	UTSW	15	55036535	missense	probably benign	0.26
R8937:Taf2	UTSW	15	55047453	missense	probably benign	0.16
R9006:Taf2	UTSW	15	55045905	missense	possibly damaging	0.94
R9138:Taf2	UTSW	15	55016461	small deletion	probably benign
R9240:Taf2	UTSW	15	55063068	missense	probably null	1.00
R9257:Taf2	UTSW	15	55066013	missense	possibly damaging	0.46
R9485:Taf2	UTSW	15	55048271	missense	probably benign	0.05
R9762:Taf2	UTSW	15	55031044	critical splice donor site	probably null
R9766:Taf2	UTSW	15	55047485	critical splice acceptor site	probably null
R9796:Taf2	UTSW	15	55047436	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- ACCTGAAAATGCTCATAGAAGCG -3'
(R):5'- GATGCTCAATGTTAGCTAGGTGTAG -3'

Sequencing Primer
(F):5'- GTAAGCGGCCACTTCAACATATG -3'
(R):5'- GACACATAAGAGATTATGCTAAGCC -3'

Posted On

2019-05-15