Incidental Mutation 'R7094:Vmn2r99'
ID 550387
Institutional Source Beutler Lab
Gene Symbol Vmn2r99
Ensembl Gene ENSMUSG00000090304
Gene Name vomeronasal 2, receptor 99
Synonyms EG665376
MMRRC Submission 045187-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.122) question?
Stock # R7094 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 19582397-19614852 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 19599573 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 419 (M419K)
Ref Sequence ENSEMBL: ENSMUSP00000135236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000176107] [ENSMUST00000231989]
AlphaFold H3BK37
Predicted Effect probably benign
Transcript: ENSMUST00000176107
AA Change: M419K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000135236
Gene: ENSMUSG00000090304
AA Change: M419K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 81 448 5.7e-33 PFAM
Pfam:NCD3G 508 561 1.8e-21 PFAM
Pfam:7tm_3 593 829 4.6e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231989
AA Change: M419K

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (59/61)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,248,610 (GRCm39) I2786F probably damaging Het
Actl6a A T 3: 32,760,487 (GRCm39) probably benign Het
Actn2 A G 13: 12,324,543 (GRCm39) V100A probably damaging Het
Arfgef3 G T 10: 18,522,187 (GRCm39) A613E probably damaging Het
Atf6b G A 17: 34,872,790 (GRCm39) probably null Het
Bub1 T A 2: 127,663,681 (GRCm39) E240V probably null Het
C1ra G A 6: 124,494,684 (GRCm39) E316K probably benign Het
Ccdc141 C A 2: 76,871,797 (GRCm39) R829L possibly damaging Het
Ccdc85c GCCGCCGCCGCCAGCGCCCCCCGCCGCCGCCAGCGCC GCCGCCGCCGCCAGCGCC 12: 108,240,877 (GRCm39) probably null Het
Cd209g T C 8: 4,186,790 (GRCm39) F112L possibly damaging Het
Cebpe C T 14: 54,948,060 (GRCm39) R261H probably damaging Het
Cfap100 T C 6: 90,390,436 (GRCm39) E68G Het
Chd9 A G 8: 91,716,189 (GRCm39) N921S unknown Het
Chil6 T C 3: 106,311,486 (GRCm39) N98S probably damaging Het
Clip1 T C 5: 123,761,333 (GRCm39) K734E probably benign Het
Cracd C T 5: 77,006,879 (GRCm39) P1080L unknown Het
Cyp11b2 A G 15: 74,725,507 (GRCm39) F204S possibly damaging Het
Dnah5 A G 15: 28,453,482 (GRCm39) T4418A probably damaging Het
Dysf T C 6: 84,077,184 (GRCm39) V649A probably benign Het
Ergic3 G A 2: 155,858,683 (GRCm39) V270M possibly damaging Het
Eva1a C T 6: 82,069,024 (GRCm39) T117I probably damaging Het
Fat4 G A 3: 38,944,023 (GRCm39) G972D probably damaging Het
Gm14412 A T 2: 177,009,138 (GRCm39) N39K probably damaging Het
Gm5565 T C 5: 146,095,084 (GRCm39) T221A probably benign Het
Gnptab T G 10: 88,215,366 (GRCm39) V29G possibly damaging Het
Grem2 T C 1: 174,664,555 (GRCm39) Y98C probably damaging Het
Grik2 A T 10: 49,232,012 (GRCm39) I506N possibly damaging Het
Has2 T A 15: 56,545,017 (GRCm39) Y195F probably damaging Het
Kics2 A G 10: 121,576,098 (GRCm39) Y73C possibly damaging Het
Lars2 T C 9: 123,288,650 (GRCm39) L832P probably damaging Het
Lipo5 T A 19: 33,446,249 (GRCm39) E49D probably damaging Het
Macc1 T A 12: 119,414,126 (GRCm39) Y767* probably null Het
Map2 G T 1: 66,451,886 (GRCm39) E259* probably null Het
Mcm9 T C 10: 53,496,253 (GRCm39) D310G probably damaging Het
Mink1 C A 11: 70,500,901 (GRCm39) probably null Het
Mtrr T C 13: 68,727,803 (GRCm39) T48A possibly damaging Het
Nrsn1 A T 13: 25,437,724 (GRCm39) I68N possibly damaging Het
Or1ab2 A T 8: 72,863,347 (GRCm39) probably benign Het
Or4a71 A T 2: 89,357,902 (GRCm39) I284K probably damaging Het
Or51f23b A G 7: 102,402,305 (GRCm39) M277T probably benign Het
Or5p60 G T 7: 107,723,840 (GRCm39) T210N probably benign Het
Or8k36-ps1 T C 2: 86,437,672 (GRCm39) N81S unknown Het
Pcdh17 A G 14: 84,684,835 (GRCm39) D434G probably damaging Het
Rnf213 T A 11: 119,328,430 (GRCm39) probably null Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,957,756 (GRCm39) probably benign Het
Sez6l2 A G 7: 126,552,096 (GRCm39) E121G probably damaging Het
Slc35e4 T C 11: 3,863,118 (GRCm39) S24G probably benign Het
Slc39a2 G T 14: 52,131,146 (GRCm39) probably benign Het
Slitrk5 C T 14: 111,918,268 (GRCm39) P631S probably benign Het
Taf2 A G 15: 54,923,482 (GRCm39) V265A probably benign Het
Tas2r106 T C 6: 131,655,542 (GRCm39) N103S probably benign Het
Tgm1 T C 14: 55,942,300 (GRCm39) T684A possibly damaging Het
Tgm7 C T 2: 120,929,489 (GRCm39) G262S probably damaging Het
Tpp2 T A 1: 44,008,148 (GRCm39) S451T probably damaging Het
Trim15 T C 17: 37,173,788 (GRCm39) Y240C probably benign Het
Trio A T 15: 27,891,534 (GRCm39) C465S unknown Het
Ttc22 G A 4: 106,493,104 (GRCm39) W250* probably null Het
Upb1 C A 10: 75,274,042 (GRCm39) F356L probably damaging Het
Vstm2a G A 11: 16,207,990 (GRCm39) probably benign Het
Zfp820 T C 17: 22,038,246 (GRCm39) T361A probably benign Het
Other mutations in Vmn2r99
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Vmn2r99 APN 17 19,599,116 (GRCm39) missense probably benign 0.01
IGL01113:Vmn2r99 APN 17 19,614,518 (GRCm39) missense probably benign 0.20
IGL01138:Vmn2r99 APN 17 19,602,885 (GRCm39) missense probably damaging 0.97
IGL01646:Vmn2r99 APN 17 19,613,920 (GRCm39) splice site probably benign
IGL01769:Vmn2r99 APN 17 19,600,377 (GRCm39) missense probably damaging 1.00
IGL02112:Vmn2r99 APN 17 19,600,494 (GRCm39) missense probably null 0.99
IGL02891:Vmn2r99 APN 17 19,598,952 (GRCm39) nonsense probably null
IGL03132:Vmn2r99 APN 17 19,598,485 (GRCm39) nonsense probably null
FR4548:Vmn2r99 UTSW 17 19,614,547 (GRCm39) missense probably damaging 0.97
FR4976:Vmn2r99 UTSW 17 19,614,547 (GRCm39) missense probably damaging 0.97
PIT4382001:Vmn2r99 UTSW 17 19,614,605 (GRCm39) missense probably damaging 1.00
R0196:Vmn2r99 UTSW 17 19,614,835 (GRCm39) missense probably benign 0.00
R0720:Vmn2r99 UTSW 17 19,599,305 (GRCm39) missense probably benign 0.00
R1501:Vmn2r99 UTSW 17 19,582,521 (GRCm39) missense possibly damaging 0.93
R1519:Vmn2r99 UTSW 17 19,600,322 (GRCm39) missense probably benign 0.00
R1670:Vmn2r99 UTSW 17 19,582,514 (GRCm39) missense probably benign 0.37
R1682:Vmn2r99 UTSW 17 19,598,207 (GRCm39) missense probably damaging 0.97
R1873:Vmn2r99 UTSW 17 19,582,415 (GRCm39) missense probably benign 0.25
R1967:Vmn2r99 UTSW 17 19,599,077 (GRCm39) missense probably benign 0.01
R2101:Vmn2r99 UTSW 17 19,598,253 (GRCm39) missense probably damaging 1.00
R2474:Vmn2r99 UTSW 17 19,598,891 (GRCm39) missense probably benign 0.04
R2519:Vmn2r99 UTSW 17 19,598,970 (GRCm39) missense probably damaging 0.99
R3911:Vmn2r99 UTSW 17 19,614,635 (GRCm39) missense possibly damaging 0.92
R3947:Vmn2r99 UTSW 17 19,599,252 (GRCm39) missense probably benign 0.40
R3949:Vmn2r99 UTSW 17 19,599,252 (GRCm39) missense probably benign 0.40
R4016:Vmn2r99 UTSW 17 19,598,832 (GRCm39) missense possibly damaging 0.86
R4413:Vmn2r99 UTSW 17 19,599,522 (GRCm39) missense probably damaging 1.00
R4594:Vmn2r99 UTSW 17 19,613,924 (GRCm39) missense probably damaging 1.00
R4999:Vmn2r99 UTSW 17 19,582,397 (GRCm39) start codon destroyed probably null 0.96
R5206:Vmn2r99 UTSW 17 19,598,868 (GRCm39) missense probably benign 0.40
R5362:Vmn2r99 UTSW 17 19,599,601 (GRCm39) missense probably benign 0.00
R5377:Vmn2r99 UTSW 17 19,599,531 (GRCm39) missense probably damaging 1.00
R5455:Vmn2r99 UTSW 17 19,614,408 (GRCm39) nonsense probably null
R6021:Vmn2r99 UTSW 17 19,598,210 (GRCm39) missense probably damaging 1.00
R6059:Vmn2r99 UTSW 17 19,599,242 (GRCm39) missense probably benign 0.00
R6214:Vmn2r99 UTSW 17 19,602,820 (GRCm39) missense probably benign 0.19
R6215:Vmn2r99 UTSW 17 19,602,820 (GRCm39) missense probably benign 0.19
R6313:Vmn2r99 UTSW 17 19,602,867 (GRCm39) missense probably damaging 1.00
R6646:Vmn2r99 UTSW 17 19,600,293 (GRCm39) missense probably damaging 1.00
R6810:Vmn2r99 UTSW 17 19,600,296 (GRCm39) missense probably benign 0.20
R6885:Vmn2r99 UTSW 17 19,600,457 (GRCm39) missense possibly damaging 0.52
R6991:Vmn2r99 UTSW 17 19,598,372 (GRCm39) missense probably benign 0.03
R7060:Vmn2r99 UTSW 17 19,614,826 (GRCm39) nonsense probably null
R7090:Vmn2r99 UTSW 17 19,613,972 (GRCm39) missense possibly damaging 0.83
R7449:Vmn2r99 UTSW 17 19,599,407 (GRCm39) missense probably benign 0.01
R7789:Vmn2r99 UTSW 17 19,614,079 (GRCm39) missense possibly damaging 0.91
R8039:Vmn2r99 UTSW 17 19,600,302 (GRCm39) missense probably benign 0.00
R8493:Vmn2r99 UTSW 17 19,614,020 (GRCm39) missense probably benign 0.15
R8511:Vmn2r99 UTSW 17 19,614,443 (GRCm39) missense probably damaging 1.00
R8715:Vmn2r99 UTSW 17 19,613,922 (GRCm39) critical splice acceptor site probably benign
R9462:Vmn2r99 UTSW 17 19,598,388 (GRCm39) nonsense probably null
R9681:Vmn2r99 UTSW 17 19,598,889 (GRCm39) missense probably damaging 1.00
R9737:Vmn2r99 UTSW 17 19,582,563 (GRCm39) missense probably benign
Z1088:Vmn2r99 UTSW 17 19,599,563 (GRCm39) missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- TCCTAAGCTGTGGCATTTGTTC -3'
(R):5'- ATTTGCTCCTGGTATCTTGTACATG -3'

Sequencing Primer
(F):5'- CTAAGCTGTGGCATTTGTTCTTCAAG -3'
(R):5'- GCTCCTGGTATCTTGTACATGATTTC -3'
Posted On 2019-05-15