Incidental Mutation 'R0615:Zfp474'
ID55039
Institutional Source Beutler Lab
Gene Symbol Zfp474
Ensembl Gene ENSMUSG00000046886
Gene Namezinc finger protein 474
Synonyms4933409D10Rik
MMRRC Submission 038804-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R0615 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location52615915-52639830 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 52638349 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 25 (L25F)
Ref Sequence ENSEMBL: ENSMUSP00000147873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072666] [ENSMUST00000209270]
Predicted Effect probably benign
Transcript: ENSMUST00000072666
AA Change: L25F

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000072453
Gene: ENSMUSG00000046886
AA Change: L25F

DomainStartEndE-ValueType
Pfam:zf-C2HC_2 90 114 1.8e-10 PFAM
Pfam:zf-C2HC_2 161 185 3.3e-13 PFAM
Pfam:zf-C2HC_2 217 241 1.2e-10 PFAM
low complexity region 250 267 N/A INTRINSIC
Pfam:zf-C2HC_2 280 304 1.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209270
AA Change: L25F

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
Meta Mutation Damage Score 0.0855 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik C A 11: 29,824,515 R314L probably damaging Het
4933411K16Rik T C 19: 42,052,523 I31T possibly damaging Het
Abca13 A G 11: 9,256,197 I166V probably damaging Het
Acaa2 G T 18: 74,798,446 V238L probably benign Het
Ahsg A T 16: 22,899,055 I296F possibly damaging Het
Aspm T A 1: 139,487,289 V1436D probably damaging Het
Ate1 A T 7: 130,513,833 probably benign Het
Atp1a4 A T 1: 172,232,060 probably benign Het
Aurkc A T 7: 7,002,403 I223L possibly damaging Het
Bckdha G T 7: 25,641,785 D50E probably benign Het
Brf2 C T 8: 27,124,031 E376K probably benign Het
Cdk9 C A 2: 32,709,801 L141F possibly damaging Het
Cgn A C 3: 94,770,714 probably benign Het
Clcn1 G A 6: 42,305,575 V526I probably damaging Het
Cnot2 A G 10: 116,498,236 V343A possibly damaging Het
Commd2 A T 3: 57,646,695 V195D possibly damaging Het
Cubn C T 2: 13,360,252 probably null Het
Eif2ak4 C T 2: 118,436,185 T729M probably damaging Het
Elac1 A T 18: 73,738,883 V347E probably damaging Het
Fam209 T C 2: 172,474,133 S143P probably benign Het
Fam20c G A 5: 138,807,486 R454Q probably damaging Het
Fam214a T A 9: 75,004,288 Y14N probably damaging Het
Faxc C T 4: 21,958,608 S255L probably benign Het
Foxj1 T C 11: 116,334,082 D153G possibly damaging Het
Gm6605 C A 7: 38,448,275 noncoding transcript Het
Lmo7 T A 14: 101,876,859 Y12* probably null Het
Matn3 T G 12: 8,963,594 C425W probably damaging Het
Mmd2 A T 5: 142,564,913 M190K probably benign Het
Morn2 A T 17: 80,295,597 T102S probably damaging Het
Nr3c2 A C 8: 77,185,889 T710P probably benign Het
Nrros C A 16: 32,144,085 L343F probably damaging Het
Ntrk2 C T 13: 59,128,186 Q767* probably null Het
Olfr1297 C T 2: 111,621,919 D52N possibly damaging Het
Olfr92 G C 17: 37,111,455 L176V probably benign Het
Plekhf2 C T 4: 10,991,330 R4H probably benign Het
Ppox A G 1: 171,277,814 probably benign Het
Qprt T A 7: 127,109,076 D61V probably damaging Het
Reln A G 5: 22,010,150 V1101A probably benign Het
Sbno1 T C 5: 124,410,139 N124D probably damaging Het
Scx C T 15: 76,458,095 P165L probably benign Het
Sema6d T C 2: 124,654,135 probably benign Het
Serf2 T C 2: 121,450,855 F92L probably benign Het
Synpo2 A T 3: 123,117,287 N236K probably damaging Het
Tbc1d32 C A 10: 56,224,640 D81Y probably benign Het
Terf2 G A 8: 107,082,990 T232I possibly damaging Het
Tpd52l2 A G 2: 181,501,951 E50G probably damaging Het
Tprn A G 2: 25,264,198 E504G probably damaging Het
Tufm G T 7: 126,487,482 R12L probably benign Het
Vmn2r8 A G 5: 108,799,329 F519S probably damaging Het
Vwa8 T C 14: 78,908,150 V89A probably benign Het
Wnt3 T C 11: 103,812,381 I230T possibly damaging Het
Zan A T 5: 137,468,431 F388Y probably damaging Het
Other mutations in Zfp474
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Zfp474 APN 18 52638493 missense possibly damaging 0.52
IGL01651:Zfp474 APN 18 52638583 missense probably damaging 1.00
IGL01750:Zfp474 APN 18 52639277 missense possibly damaging 0.59
IGL02013:Zfp474 APN 18 52638899 missense possibly damaging 0.86
PIT4469001:Zfp474 UTSW 18 52638719 missense possibly damaging 0.77
PIT4618001:Zfp474 UTSW 18 52638404 missense probably damaging 0.97
R1178:Zfp474 UTSW 18 52638742 nonsense probably null
R1180:Zfp474 UTSW 18 52638742 nonsense probably null
R1610:Zfp474 UTSW 18 52638365 missense probably benign
R1819:Zfp474 UTSW 18 52638800 missense probably damaging 1.00
R4854:Zfp474 UTSW 18 52638431 missense possibly damaging 0.59
R6270:Zfp474 UTSW 18 52638364 missense probably benign
R7574:Zfp474 UTSW 18 52639189 missense probably benign 0.00
R8194:Zfp474 UTSW 18 52639157 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAAGTACTGGCAACATGTGGAAG -3'
(R):5'- TCATGAATGGCAAGTGACTGGGAC -3'

Sequencing Primer
(F):5'- CATGTGGAAGCCCAGGAC -3'
(R):5'- TTCTCGGCCACAAATATAGCATATC -3'
Posted On2013-07-11