Mutagenetix > Incidental Mutations

Incidental Mutation 'R7095:Irs1'

550392

Institutional Source

Beutler Lab

Gene Symbol

Irs1

Ensembl Gene

ENSMUSG00000055980

Gene Name

insulin receptor substrate 1

Synonyms

G972R, IRS-1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.592) question?

Stock #

R7095 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

82233101-82291416 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 82290098 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 132 (C132*)

Ref Sequence

ENSEMBL: ENSMUSP00000063795 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069799]

Predicted Effect

probably null
Transcript: ENSMUST00000069799
AA Change: C132*

SMART Domains

Protein: ENSMUSP00000063795
Gene: ENSMUSG00000055980
AA Change: C132*

Domain	Start	End	E-Value	Type
PH	13	117	8.13e-14	SMART
low complexity region	123	143	N/A	INTRINSIC
IRS	155	257	1.19e-35	SMART
PTBI	155	257	7.8e-60	SMART
low complexity region	263	276	N/A	INTRINSIC
low complexity region	378	399	N/A	INTRINSIC
low complexity region	407	419	N/A	INTRINSIC
low complexity region	551	568	N/A	INTRINSIC
low complexity region	662	689	N/A	INTRINSIC
low complexity region	784	794	N/A	INTRINSIC
low complexity region	801	810	N/A	INTRINSIC
low complexity region	824	837	N/A	INTRINSIC
low complexity region	1019	1040	N/A	INTRINSIC
low complexity region	1051	1062	N/A	INTRINSIC
low complexity region	1111	1127	N/A	INTRINSIC
low complexity region	1185	1200	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

99% (71/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is phosphorylated by insulin receptor tyrosine kinase. Mutations in this gene are associated with type II diabetes and susceptibility to insulin resistance. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit 50 percent reductions in body weights at birth and at 4 months of age, impaired glucose tolerance, and mild insulin and IGF-1 resistance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcf1	A	G	17: 35,957,511	V809A	possibly damaging	Het
Adam32	T	A	8: 24,914,070	D242V	probably damaging	Het
Adamts9	T	A	6: 92,887,691	H763L	probably benign	Het
Aff1	A	G	5: 103,843,085	D967G	probably damaging	Het
Anpep	A	T	7: 79,842,202	L17Q	possibly damaging	Het
Appbp2	G	T	11: 85,234,727	S28*	probably null	Het
Bach1	G	A	16: 87,719,291	R240Q	probably benign	Het
Bod1l	A	G	5: 41,795,068		probably null	Het
Capn5	G	A	7: 98,125,831	T534I	probably benign	Het
Cbx2	T	C	11: 119,028,059	I150T	probably damaging	Het
Cdh11	A	G	8: 102,658,267	V392A	probably damaging	Het
Cenpf	A	T	1: 189,659,176	C803S	probably benign	Het
Cep135	A	G	5: 76,594,058	T114A	probably benign	Het
Chd2	A	T	7: 73,471,881	D994E	probably damaging	Het
Chtf18	C	A	17: 25,722,678	W584C	probably damaging	Het
Dclk2	C	T	3: 86,793,259	R638H	probably damaging	Het
Dgkh	C	A	14: 78,627,784	M172I	probably benign	Het
Dpy19l2	T	G	9: 24,695,814	H117P	probably benign	Het
Dzip3	A	T	16: 48,927,790	N908K	probably benign	Het
Erc2	A	T	14: 27,898,593	N393Y	probably damaging	Het
Fam118b	T	C	9: 35,221,490	E291G	possibly damaging	Het
Fam193a	C	T	5: 34,458,034	L816F	probably damaging	Het
Fat2	A	G	11: 55,311,331	Y306H	probably damaging	Het
Fndc10	C	T	4: 155,695,117	T206I	probably damaging	Het
Fzd1	GGGACTCCTCCACCTCCCTGGA	GGGA	5: 4,755,824		probably benign	Het
Gsk3a	A	T	7: 25,233,854	Y177N	probably damaging	Het
Haus5	T	C	7: 30,659,572	T222A	probably benign	Het
Igfbp7	G	T	5: 77,401,490	Q189K	probably benign	Het
Inppl1	A	T	7: 101,827,456	Y771*	probably null	Het
Iqck	A	T	7: 118,915,591	Y234F	probably damaging	Het
Jmjd1c	T	G	10: 67,219,632	V277G	probably benign	Het
Klhl22	G	A	16: 17,792,750	V622M	probably damaging	Het
Kri1	C	T	9: 21,279,432	E378K		Het
Lilra6	C	T	7: 3,913,197	G221D	probably damaging	Het
Marc1	A	G	1: 184,795,240	L297P	probably damaging	Het
Mecom	T	C	3: 29,980,954	E191G	probably damaging	Het
Mgrn1	T	A	16: 4,927,664		probably null	Het
Mical1	C	T	10: 41,479,210		probably null	Het
Mlxipl	T	C	5: 135,134,030	Y711H	possibly damaging	Het
Mpl	T	A	4: 118,444,063	H535L		Het
Mtfr2	C	A	10: 20,352,920	H71N	probably benign	Het
Mtrf1	GCCTTC	GC	14: 79,423,491		probably null	Het
Myh15	A	G	16: 49,171,909	Q1582R	possibly damaging	Het
Neb	C	T	2: 52,177,623	E6062K	possibly damaging	Het
Nlrp4c	G	A	7: 6,060,793	A67T	probably damaging	Het
Noc3l	T	A	19: 38,812,345	H231L	probably benign	Het
Odf1	T	C	15: 38,219,559	Y44H	possibly damaging	Het
Olfr1052	C	T	2: 86,298,677	P287L	probably benign	Het
Olfr589	G	A	7: 103,155,330	T139I	probably damaging	Het
Olfr591	C	T	7: 103,173,046	R197H	probably benign	Het
Otol1	G	T	3: 70,018,694	E67D	probably benign	Het
Otud7b	A	G	3: 96,155,237	S598G	probably benign	Het
Ppwd1	T	A	13: 104,205,626	T607S	probably benign	Het
Prag1	A	G	8: 36,102,560	N99S	probably benign	Het
Ralgds	C	A	2: 28,549,308	Q737K	possibly damaging	Het
Scyl2	T	C	10: 89,669,687	H98R	probably damaging	Het
Secisbp2	A	C	13: 51,677,254	Q575H	probably benign	Het
Slc9a5	A	T	8: 105,357,636	H497L	probably benign	Het
Sufu	T	A	19: 46,475,588	V414E	probably damaging	Het
Tbc1d22b	A	T	17: 29,599,869	E399V	probably damaging	Het
Tcp10c	G	A	17: 13,355,934	V59I	probably benign	Het
Tdpoz3	T	C	3: 93,827,061	S348P	probably benign	Het
Tmem219	A	T	7: 126,891,756	F176L	probably damaging	Het
Trav6-2	A	G	14: 52,667,834	D104G	probably damaging	Het
Uba7	A	G	9: 107,983,339	K927R	probably benign	Het
Vps54	T	G	11: 21,271,720	D158E	probably benign	Het
Xpnpep1	C	T	19: 53,011,765		probably null	Het
Xpo7	G	A	14: 70,704,706	R73W	probably damaging	Het
Zfp532	A	T	18: 65,682,898	M781L	probably benign	Het
Zfp930	T	A	8: 69,228,541	I295K	probably benign	Het

Other mutations in Irs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00325:Irs1	APN	1	82288483	missense	probably benign	0.01
IGL00534:Irs1	APN	1	82288471	missense	probably benign
IGL01926:Irs1	APN	1	82289959	missense	probably damaging	0.98
IGL02130:Irs1	APN	1	82289467	missense	probably damaging	1.00
IGL03338:Irs1	APN	1	82288401	missense	probably benign	0.05
Hoverboard	UTSW	1	82290098	nonsense	probably null
runt	UTSW	1	82287732	frame shift	probably null
runt2	UTSW	1	82286967	nonsense	probably null
R0019:Irs1	UTSW	1	82287256	nonsense	probably null
R0063:Irs1	UTSW	1	82288859	missense	probably damaging	1.00
R0063:Irs1	UTSW	1	82288859	missense	probably damaging	1.00
R0318:Irs1	UTSW	1	82288660	missense	probably benign	0.01
R1199:Irs1	UTSW	1	82289626	missense	probably damaging	1.00
R1363:Irs1	UTSW	1	82287288	missense	probably benign	0.02
R1584:Irs1	UTSW	1	82289444	missense	probably benign	0.24
R1874:Irs1	UTSW	1	82289853	frame shift	probably null
R1903:Irs1	UTSW	1	82289461	missense	probably damaging	1.00
R1929:Irs1	UTSW	1	82288459	missense	probably benign
R1986:Irs1	UTSW	1	82288765	missense	probably damaging	1.00
R2136:Irs1	UTSW	1	82290042	missense	probably damaging	1.00
R2179:Irs1	UTSW	1	82290219	missense	possibly damaging	0.81
R2271:Irs1	UTSW	1	82288459	missense	probably benign
R2760:Irs1	UTSW	1	82288570	missense	probably damaging	1.00
R3721:Irs1	UTSW	1	82290085	missense	probably benign	0.11
R3821:Irs1	UTSW	1	82290049	missense	probably benign
R4306:Irs1	UTSW	1	82287964	missense	probably benign	0.11
R4420:Irs1	UTSW	1	82288450	missense	possibly damaging	0.94
R4451:Irs1	UTSW	1	82289028	missense	probably benign	0.00
R4479:Irs1	UTSW	1	82287294	missense	probably damaging	1.00
R4771:Irs1	UTSW	1	82287975	missense	probably benign	0.00
R4782:Irs1	UTSW	1	82287463	missense	probably benign	0.00
R4836:Irs1	UTSW	1	82287732	frame shift	probably null
R4880:Irs1	UTSW	1	82287732	frame shift	probably null
R4881:Irs1	UTSW	1	82287732	frame shift	probably null
R5031:Irs1	UTSW	1	82286967	nonsense	probably null
R5053:Irs1	UTSW	1	82286922	missense	probably benign
R5418:Irs1	UTSW	1	82288770	missense	probably damaging	1.00
R5595:Irs1	UTSW	1	82289925	missense	probably damaging	1.00
R5698:Irs1	UTSW	1	82288734	missense	probably benign	0.01
R6381:Irs1	UTSW	1	82287684	missense	possibly damaging	0.66
R6563:Irs1	UTSW	1	82288407	missense	probably damaging	0.98
R7002:Irs1	UTSW	1	82288260	missense	probably benign	0.13
R7195:Irs1	UTSW	1	82287456	missense	probably benign	0.13
R7216:Irs1	UTSW	1	82289755	missense	probably damaging	0.98
R7361:Irs1	UTSW	1	82289114	nonsense	probably null
R7490:Irs1	UTSW	1	82287264	missense	probably damaging	0.99
R7540:Irs1	UTSW	1	82288002	missense	not run
R7706:Irs1	UTSW	1	82287691	missense	probably damaging	1.00
R7910:Irs1	UTSW	1	82290081	missense	probably benign	0.06
R7912:Irs1	UTSW	1	82289884	missense	probably benign
R7991:Irs1	UTSW	1	82290081	missense	probably benign	0.06
R7993:Irs1	UTSW	1	82289884	missense	probably benign
X0063:Irs1	UTSW	1	82288908	missense	probably damaging	1.00
X0065:Irs1	UTSW	1	82289365	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TATTCATCAGCTGCAGCACC -3'
(R):5'- ATCAACAAGCGGGCTGACTC -3'

Sequencing Primer
(F):5'- TCGGAGTTCAGCTTCACAAAG -3'
(R):5'- TCCAAGAACAAGCACCTGGTGG -3'

Posted On

2019-05-15