Incidental Mutation 'R7095:Capn5'
ID 550419
Institutional Source Beutler Lab
Gene Symbol Capn5
Ensembl Gene ENSMUSG00000035547
Gene Name calpain 5
Synonyms
MMRRC Submission 045243-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R7095 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 97770766-97827481 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 97775038 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 534 (T534I)
Ref Sequence ENSEMBL: ENSMUSP00000048183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040971] [ENSMUST00000107112]
AlphaFold O08688
Predicted Effect probably benign
Transcript: ENSMUST00000040971
AA Change: T534I

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000048183
Gene: ENSMUSG00000035547
AA Change: T534I

DomainStartEndE-ValueType
CysPc 8 351 4.18e-212 SMART
calpain_III 353 496 1.21e-66 SMART
C2 518 619 1.29e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107112
AA Change: T534I

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000102729
Gene: ENSMUSG00000035547
AA Change: T534I

DomainStartEndE-ValueType
CysPc 8 351 4.18e-212 SMART
calpain_III 353 496 1.21e-66 SMART
C2 518 619 1.29e-9 SMART
Meta Mutation Damage Score 0.1497 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the calpain family of proteins. Unlike many members of the calpain gene family, this gene lacks a calmodulin-like domain, required for calcium binding. Mouse models for Huntington's disease displayed increased levels of the protein encoded by this gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for one allele of this gene occasionally exhibit reduced viability but are usually normal. Homozygotes for another allele die as embryos. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 A G 17: 36,268,403 (GRCm39) V809A possibly damaging Het
Adam32 T A 8: 25,404,086 (GRCm39) D242V probably damaging Het
Adamts9 T A 6: 92,864,672 (GRCm39) H763L probably benign Het
Aff1 A G 5: 103,990,951 (GRCm39) D967G probably damaging Het
Anpep A T 7: 79,491,950 (GRCm39) L17Q possibly damaging Het
Appbp2 G T 11: 85,125,553 (GRCm39) S28* probably null Het
Bach1 G A 16: 87,516,179 (GRCm39) R240Q probably benign Het
Bod1l A G 5: 41,952,411 (GRCm39) probably null Het
Cbx2 T C 11: 118,918,885 (GRCm39) I150T probably damaging Het
Cdh11 A G 8: 103,384,899 (GRCm39) V392A probably damaging Het
Cenpf A T 1: 189,391,373 (GRCm39) C803S probably benign Het
Cep135 A G 5: 76,741,905 (GRCm39) T114A probably benign Het
Chd2 A T 7: 73,121,629 (GRCm39) D994E probably damaging Het
Chtf18 C A 17: 25,941,652 (GRCm39) W584C probably damaging Het
Dclk2 C T 3: 86,700,566 (GRCm39) R638H probably damaging Het
Dgkh C A 14: 78,865,224 (GRCm39) M172I probably benign Het
Dpy19l2 T G 9: 24,607,110 (GRCm39) H117P probably benign Het
Dzip3 A T 16: 48,748,153 (GRCm39) N908K probably benign Het
Erc2 A T 14: 27,620,550 (GRCm39) N393Y probably damaging Het
Fam118b T C 9: 35,132,786 (GRCm39) E291G possibly damaging Het
Fam193a C T 5: 34,615,378 (GRCm39) L816F probably damaging Het
Fat2 A G 11: 55,202,157 (GRCm39) Y306H probably damaging Het
Fndc10 C T 4: 155,779,574 (GRCm39) T206I probably damaging Het
Fzd1 GGGACTCCTCCACCTCCCTGGA GGGA 5: 4,805,824 (GRCm39) probably benign Het
Gsk3a A T 7: 24,933,279 (GRCm39) Y177N probably damaging Het
Haus5 T C 7: 30,358,997 (GRCm39) T222A probably benign Het
Igfbp7 G T 5: 77,549,337 (GRCm39) Q189K probably benign Het
Inppl1 A T 7: 101,476,663 (GRCm39) Y771* probably null Het
Iqck A T 7: 118,514,814 (GRCm39) Y234F probably damaging Het
Irs1 G T 1: 82,267,819 (GRCm39) C132* probably null Het
Jmjd1c T G 10: 67,055,411 (GRCm39) V277G probably benign Het
Klhl22 G A 16: 17,610,614 (GRCm39) V622M probably damaging Het
Kri1 C T 9: 21,190,728 (GRCm39) E378K Het
Lilra6 C T 7: 3,916,196 (GRCm39) G221D probably damaging Het
Mecom T C 3: 30,035,103 (GRCm39) E191G probably damaging Het
Mgrn1 T A 16: 4,745,528 (GRCm39) probably null Het
Mical1 C T 10: 41,355,206 (GRCm39) probably null Het
Mlxipl T C 5: 135,162,884 (GRCm39) Y711H possibly damaging Het
Mpl T A 4: 118,301,260 (GRCm39) H535L Het
Mtarc1 A G 1: 184,527,437 (GRCm39) L297P probably damaging Het
Mtfr2 C A 10: 20,228,666 (GRCm39) H71N probably benign Het
Mtrf1 GCCTTC GC 14: 79,660,931 (GRCm39) probably null Het
Myh15 A G 16: 48,992,272 (GRCm39) Q1582R possibly damaging Het
Neb C T 2: 52,067,635 (GRCm39) E6062K possibly damaging Het
Nlrp4c G A 7: 6,063,792 (GRCm39) A67T probably damaging Het
Noc3l T A 19: 38,800,789 (GRCm39) H231L probably benign Het
Odf1 T C 15: 38,219,803 (GRCm39) Y44H possibly damaging Het
Or52e2 G A 7: 102,804,537 (GRCm39) T139I probably damaging Het
Or52s1b C T 7: 102,822,253 (GRCm39) R197H probably benign Het
Or5j3 C T 2: 86,129,021 (GRCm39) P287L probably benign Het
Otol1 G T 3: 69,926,027 (GRCm39) E67D probably benign Het
Otud7b A G 3: 96,062,554 (GRCm39) S598G probably benign Het
Ppwd1 T A 13: 104,342,134 (GRCm39) T607S probably benign Het
Prag1 A G 8: 36,569,714 (GRCm39) N99S probably benign Het
Ralgds C A 2: 28,439,320 (GRCm39) Q737K possibly damaging Het
Scyl2 T C 10: 89,505,549 (GRCm39) H98R probably damaging Het
Secisbp2 A C 13: 51,831,290 (GRCm39) Q575H probably benign Het
Slc9a5 A T 8: 106,084,268 (GRCm39) H497L probably benign Het
Sufu T A 19: 46,464,027 (GRCm39) V414E probably damaging Het
Tbc1d22b A T 17: 29,818,843 (GRCm39) E399V probably damaging Het
Tcp10c G A 17: 13,576,196 (GRCm39) V59I probably benign Het
Tdpoz3 T C 3: 93,734,368 (GRCm39) S348P probably benign Het
Tmem219 A T 7: 126,490,928 (GRCm39) F176L probably damaging Het
Trav6-2 A G 14: 52,905,291 (GRCm39) D104G probably damaging Het
Uba7 A G 9: 107,860,538 (GRCm39) K927R probably benign Het
Vps54 T G 11: 21,221,720 (GRCm39) D158E probably benign Het
Xpnpep1 C T 19: 53,000,196 (GRCm39) probably null Het
Xpo7 G A 14: 70,942,146 (GRCm39) R73W probably damaging Het
Zfp532 A T 18: 65,815,969 (GRCm39) M781L probably benign Het
Zfp930 T A 8: 69,681,193 (GRCm39) I295K probably benign Het
Other mutations in Capn5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Capn5 APN 7 97,784,971 (GRCm39) missense probably damaging 1.00
IGL01311:Capn5 APN 7 97,811,130 (GRCm39) missense probably damaging 1.00
IGL01768:Capn5 APN 7 97,774,480 (GRCm39) missense probably damaging 1.00
IGL01926:Capn5 APN 7 97,777,679 (GRCm39) critical splice donor site probably null
IGL02076:Capn5 APN 7 97,780,950 (GRCm39) nonsense probably null
IGL02505:Capn5 APN 7 97,780,403 (GRCm39) missense possibly damaging 0.85
BB007:Capn5 UTSW 7 97,773,085 (GRCm39) missense probably benign
BB017:Capn5 UTSW 7 97,773,085 (GRCm39) missense probably benign
PIT4466001:Capn5 UTSW 7 97,773,195 (GRCm39) missense probably benign 0.00
R0178:Capn5 UTSW 7 97,782,098 (GRCm39) missense probably damaging 1.00
R0518:Capn5 UTSW 7 97,782,089 (GRCm39) missense probably damaging 1.00
R0521:Capn5 UTSW 7 97,782,089 (GRCm39) missense probably damaging 1.00
R1459:Capn5 UTSW 7 97,781,049 (GRCm39) missense possibly damaging 0.84
R2005:Capn5 UTSW 7 97,778,570 (GRCm39) missense probably benign
R2258:Capn5 UTSW 7 97,785,082 (GRCm39) missense probably damaging 0.99
R2327:Capn5 UTSW 7 97,775,574 (GRCm39) missense probably benign 0.07
R3797:Capn5 UTSW 7 97,775,036 (GRCm39) missense probably null 0.77
R4032:Capn5 UTSW 7 97,778,453 (GRCm39) missense probably damaging 0.96
R4620:Capn5 UTSW 7 97,778,578 (GRCm39) missense probably damaging 0.98
R4717:Capn5 UTSW 7 97,773,126 (GRCm39) missense probably benign 0.02
R4777:Capn5 UTSW 7 97,780,925 (GRCm39) missense probably damaging 1.00
R4823:Capn5 UTSW 7 97,775,648 (GRCm39) missense probably damaging 1.00
R4841:Capn5 UTSW 7 97,780,879 (GRCm39) splice site probably null
R4965:Capn5 UTSW 7 97,775,624 (GRCm39) missense probably damaging 0.99
R5568:Capn5 UTSW 7 97,775,137 (GRCm39) missense probably damaging 1.00
R5732:Capn5 UTSW 7 97,778,593 (GRCm39) missense possibly damaging 0.95
R5792:Capn5 UTSW 7 97,780,402 (GRCm39) missense probably benign 0.09
R6892:Capn5 UTSW 7 97,785,148 (GRCm39) missense probably damaging 1.00
R6923:Capn5 UTSW 7 97,778,461 (GRCm39) missense probably damaging 1.00
R7391:Capn5 UTSW 7 97,780,426 (GRCm39) missense probably benign 0.02
R7553:Capn5 UTSW 7 97,773,231 (GRCm39) missense probably damaging 1.00
R7930:Capn5 UTSW 7 97,773,085 (GRCm39) missense probably benign
R8876:Capn5 UTSW 7 97,780,902 (GRCm39) missense probably benign 0.01
R8914:Capn5 UTSW 7 97,784,997 (GRCm39) missense probably damaging 0.99
R9012:Capn5 UTSW 7 97,814,050 (GRCm39) start gained probably benign
R9087:Capn5 UTSW 7 97,775,531 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGTTTCTCAGCTCAACAC -3'
(R):5'- TGAACCCCATCTGCACATTTG -3'

Sequencing Primer
(F):5'- GAAGCTGTCTCTGAACCCC -3'
(R):5'- GCACATTTGTCTTTATGCCGC -3'
Posted On 2019-05-15