Incidental Mutation 'R7095:Prag1'
ID550426
Institutional Source Beutler Lab
Gene Symbol Prag1
Ensembl Gene ENSMUSG00000050271
Gene NamePEAK1 related kinase activating pseudokinase 1
SynonymsD8Ertd82e, NACK
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7095 (G1)
Quality Score172.009
Status Validated
Chromosome8
Chromosomal Location36094828-36147787 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36102560 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 99 (N99S)
Ref Sequence ENSEMBL: ENSMUSP00000106118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110492]
Predicted Effect probably benign
Transcript: ENSMUST00000110492
AA Change: N99S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106118
Gene: ENSMUSG00000050271
AA Change: N99S

DomainStartEndE-ValueType
low complexity region 317 333 N/A INTRINSIC
low complexity region 395 412 N/A INTRINSIC
low complexity region 525 544 N/A INTRINSIC
low complexity region 781 793 N/A INTRINSIC
low complexity region 892 925 N/A INTRINSIC
Pfam:Pkinase_Tyr 1060 1288 1.7e-7 PFAM
Pfam:Pkinase 1061 1293 1.5e-13 PFAM
low complexity region 1363 1373 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that belongs to the tyrosine protein kinase family. A similar protein in rat binds to Rho family GTPase 2 (Rnd2) and regulates neurite outgrowth via activation of Ras homolog gene family, member A (RhoA). [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous disruption of this gene leads to complete embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 A G 17: 35,957,511 V809A possibly damaging Het
Adam32 T A 8: 24,914,070 D242V probably damaging Het
Adamts9 T A 6: 92,887,691 H763L probably benign Het
Aff1 A G 5: 103,843,085 D967G probably damaging Het
Anpep A T 7: 79,842,202 L17Q possibly damaging Het
Appbp2 G T 11: 85,234,727 S28* probably null Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Bod1l A G 5: 41,795,068 probably null Het
Capn5 G A 7: 98,125,831 T534I probably benign Het
Cbx2 T C 11: 119,028,059 I150T probably damaging Het
Cdh11 A G 8: 102,658,267 V392A probably damaging Het
Cenpf A T 1: 189,659,176 C803S probably benign Het
Cep135 A G 5: 76,594,058 T114A probably benign Het
Chd2 A T 7: 73,471,881 D994E probably damaging Het
Chtf18 C A 17: 25,722,678 W584C probably damaging Het
Dclk2 C T 3: 86,793,259 R638H probably damaging Het
Dgkh C A 14: 78,627,784 M172I probably benign Het
Dpy19l2 T G 9: 24,695,814 H117P probably benign Het
Dzip3 A T 16: 48,927,790 N908K probably benign Het
Erc2 A T 14: 27,898,593 N393Y probably damaging Het
Fam118b T C 9: 35,221,490 E291G possibly damaging Het
Fam193a C T 5: 34,458,034 L816F probably damaging Het
Fat2 A G 11: 55,311,331 Y306H probably damaging Het
Fndc10 C T 4: 155,695,117 T206I probably damaging Het
Fzd1 GGGACTCCTCCACCTCCCTGGA GGGA 5: 4,755,824 probably benign Het
Gsk3a A T 7: 25,233,854 Y177N probably damaging Het
Haus5 T C 7: 30,659,572 T222A probably benign Het
Igfbp7 G T 5: 77,401,490 Q189K probably benign Het
Inppl1 A T 7: 101,827,456 Y771* probably null Het
Iqck A T 7: 118,915,591 Y234F probably damaging Het
Irs1 G T 1: 82,290,098 C132* probably null Het
Jmjd1c T G 10: 67,219,632 V277G probably benign Het
Klhl22 G A 16: 17,792,750 V622M probably damaging Het
Kri1 C T 9: 21,279,432 E378K Het
Lilra6 C T 7: 3,913,197 G221D probably damaging Het
Marc1 A G 1: 184,795,240 L297P probably damaging Het
Mecom T C 3: 29,980,954 E191G probably damaging Het
Mgrn1 T A 16: 4,927,664 probably null Het
Mical1 C T 10: 41,479,210 probably null Het
Mlxipl T C 5: 135,134,030 Y711H possibly damaging Het
Mpl T A 4: 118,444,063 H535L Het
Mtfr2 C A 10: 20,352,920 H71N probably benign Het
Mtrf1 GCCTTC GC 14: 79,423,491 probably null Het
Myh15 A G 16: 49,171,909 Q1582R possibly damaging Het
Neb C T 2: 52,177,623 E6062K possibly damaging Het
Nlrp4c G A 7: 6,060,793 A67T probably damaging Het
Noc3l T A 19: 38,812,345 H231L probably benign Het
Odf1 T C 15: 38,219,559 Y44H possibly damaging Het
Olfr1052 C T 2: 86,298,677 P287L probably benign Het
Olfr589 G A 7: 103,155,330 T139I probably damaging Het
Olfr591 C T 7: 103,173,046 R197H probably benign Het
Otol1 G T 3: 70,018,694 E67D probably benign Het
Otud7b A G 3: 96,155,237 S598G probably benign Het
Ppwd1 T A 13: 104,205,626 T607S probably benign Het
Ralgds C A 2: 28,549,308 Q737K possibly damaging Het
Scyl2 T C 10: 89,669,687 H98R probably damaging Het
Secisbp2 A C 13: 51,677,254 Q575H probably benign Het
Slc9a5 A T 8: 105,357,636 H497L probably benign Het
Sufu T A 19: 46,475,588 V414E probably damaging Het
Tbc1d22b A T 17: 29,599,869 E399V probably damaging Het
Tcp10c G A 17: 13,355,934 V59I probably benign Het
Tdpoz3 T C 3: 93,827,061 S348P probably benign Het
Tmem219 A T 7: 126,891,756 F176L probably damaging Het
Trav6-2 A G 14: 52,667,834 D104G probably damaging Het
Uba7 A G 9: 107,983,339 K927R probably benign Het
Vps54 T G 11: 21,271,720 D158E probably benign Het
Xpnpep1 C T 19: 53,011,765 probably null Het
Xpo7 G A 14: 70,704,706 R73W probably damaging Het
Zfp532 A T 18: 65,682,898 M781L probably benign Het
Zfp930 T A 8: 69,228,541 I295K probably benign Het
Other mutations in Prag1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Prag1 APN 8 36099931 missense probably benign 0.01
IGL01132:Prag1 APN 8 36146357 missense probably damaging 1.00
IGL01322:Prag1 APN 8 36103934 missense probably benign 0.01
IGL01343:Prag1 APN 8 36103046 missense possibly damaging 0.95
IGL01726:Prag1 APN 8 36102992 missense probably damaging 1.00
IGL01739:Prag1 APN 8 36102680 missense probably benign 0.00
IGL02420:Prag1 APN 8 36147426 utr 3 prime probably benign
IGL02433:Prag1 APN 8 36139568 missense probably damaging 1.00
IGL02627:Prag1 APN 8 36139439 missense possibly damaging 0.93
IGL02797:Prag1 APN 8 36139501 missense probably damaging 1.00
IGL03070:Prag1 APN 8 36103549 missense probably benign 0.01
IGL03323:Prag1 APN 8 36140008 missense probably damaging 1.00
FR4340:Prag1 UTSW 8 36103886 small insertion probably benign
FR4548:Prag1 UTSW 8 36103885 small insertion probably benign
FR4589:Prag1 UTSW 8 36103883 small insertion probably benign
FR4976:Prag1 UTSW 8 36103883 small insertion probably benign
R0325:Prag1 UTSW 8 36103804 missense probably benign 0.00
R0486:Prag1 UTSW 8 36146633 missense probably damaging 1.00
R0506:Prag1 UTSW 8 36103700 missense possibly damaging 0.92
R0507:Prag1 UTSW 8 36104123 missense probably damaging 1.00
R0595:Prag1 UTSW 8 36147002 missense probably damaging 1.00
R0618:Prag1 UTSW 8 36099833 missense probably damaging 1.00
R0618:Prag1 UTSW 8 36099833 missense probably damaging 1.00
R0885:Prag1 UTSW 8 36103267 missense probably benign 0.00
R1015:Prag1 UTSW 8 36146543 missense probably damaging 1.00
R1168:Prag1 UTSW 8 36146645 missense probably damaging 1.00
R1182:Prag1 UTSW 8 36147259 missense possibly damaging 0.95
R1227:Prag1 UTSW 8 36139951 missense probably damaging 1.00
R1282:Prag1 UTSW 8 36099914 missense probably damaging 0.96
R1469:Prag1 UTSW 8 36146298 splice site probably benign
R1656:Prag1 UTSW 8 36104346 missense probably damaging 1.00
R1660:Prag1 UTSW 8 36140023 missense possibly damaging 0.73
R1676:Prag1 UTSW 8 36102898 missense probably damaging 0.96
R1820:Prag1 UTSW 8 36103804 missense probably benign 0.00
R1970:Prag1 UTSW 8 36129160 splice site probably null
R1974:Prag1 UTSW 8 36102927 missense probably damaging 1.00
R4398:Prag1 UTSW 8 36103655 missense probably damaging 1.00
R4429:Prag1 UTSW 8 36146642 missense probably damaging 1.00
R4627:Prag1 UTSW 8 36103292 missense probably damaging 1.00
R4980:Prag1 UTSW 8 36139586 missense probably damaging 1.00
R5131:Prag1 UTSW 8 36139969 missense probably damaging 1.00
R5215:Prag1 UTSW 8 36099889 missense probably benign 0.06
R5346:Prag1 UTSW 8 36103685 missense probably damaging 1.00
R5414:Prag1 UTSW 8 36139622 missense probably benign 0.00
R5535:Prag1 UTSW 8 36104014 missense probably benign
R5687:Prag1 UTSW 8 36146813 missense probably benign 0.02
R5785:Prag1 UTSW 8 36103487 missense probably benign 0.35
R5817:Prag1 UTSW 8 36103703 missense probably damaging 1.00
R6002:Prag1 UTSW 8 36104183 missense probably benign 0.31
R6127:Prag1 UTSW 8 36147401 missense unknown
R6240:Prag1 UTSW 8 36103352 missense probably benign 0.03
R6277:Prag1 UTSW 8 36146591 missense probably damaging 1.00
R6326:Prag1 UTSW 8 36102706 missense possibly damaging 0.79
R6741:Prag1 UTSW 8 36147280 missense probably benign 0.41
R6925:Prag1 UTSW 8 36103894 missense probably damaging 1.00
R7085:Prag1 UTSW 8 36104237 missense possibly damaging 0.71
R7204:Prag1 UTSW 8 36146761 missense probably benign 0.03
R7213:Prag1 UTSW 8 36146615 missense probably damaging 0.99
R7567:Prag1 UTSW 8 36102606 missense possibly damaging 0.68
R7577:Prag1 UTSW 8 36146942 missense probably damaging 1.00
R7783:Prag1 UTSW 8 36103255 missense possibly damaging 0.66
Z1177:Prag1 UTSW 8 36147142 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTGTGTCCAGTCGTGAAG -3'
(R):5'- CTGGTTGAAAGGCAGTGTTCC -3'

Sequencing Primer
(F):5'- CCAGTCGTGAAGGTGGGATG -3'
(R):5'- TGAAAGGCAGTGTTCCTATCCACG -3'
Posted On2019-05-15