Incidental Mutation 'R7095:Dpy19l2'
ID550431
Institutional Source Beutler Lab
Gene Symbol Dpy19l2
Ensembl Gene ENSMUSG00000085576
Gene Namedpy-19-like 2 (C. elegans)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R7095 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location24557047-24696293 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 24695814 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Proline at position 117 (H117P)
Ref Sequence ENSEMBL: ENSMUSP00000132092 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000133010]
Predicted Effect probably benign
Transcript: ENSMUST00000133010
AA Change: H117P

PolyPhen 2 Score 0.407 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000132092
Gene: ENSMUSG00000085576
AA Change: H117P

DomainStartEndE-ValueType
Pfam:Dpy19 129 772 3.1e-233 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the dpy-19 family. It is highly expressed in testis, and is required for sperm head elongation and acrosome formation during spermatogenesis. Mutations in this gene are associated with an infertility disorder, spermatogenic failure type 9 (SPGF9). [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male sterility associated with globozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 A G 17: 35,957,511 V809A possibly damaging Het
Adam32 T A 8: 24,914,070 D242V probably damaging Het
Adamts9 T A 6: 92,887,691 H763L probably benign Het
Aff1 A G 5: 103,843,085 D967G probably damaging Het
Anpep A T 7: 79,842,202 L17Q possibly damaging Het
Appbp2 G T 11: 85,234,727 S28* probably null Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Bod1l A G 5: 41,795,068 probably null Het
Capn5 G A 7: 98,125,831 T534I probably benign Het
Cbx2 T C 11: 119,028,059 I150T probably damaging Het
Cdh11 A G 8: 102,658,267 V392A probably damaging Het
Cenpf A T 1: 189,659,176 C803S probably benign Het
Cep135 A G 5: 76,594,058 T114A probably benign Het
Chd2 A T 7: 73,471,881 D994E probably damaging Het
Chtf18 C A 17: 25,722,678 W584C probably damaging Het
Dclk2 C T 3: 86,793,259 R638H probably damaging Het
Dgkh C A 14: 78,627,784 M172I probably benign Het
Dzip3 A T 16: 48,927,790 N908K probably benign Het
Erc2 A T 14: 27,898,593 N393Y probably damaging Het
Fam118b T C 9: 35,221,490 E291G possibly damaging Het
Fam193a C T 5: 34,458,034 L816F probably damaging Het
Fat2 A G 11: 55,311,331 Y306H probably damaging Het
Fndc10 C T 4: 155,695,117 T206I probably damaging Het
Fzd1 GGGACTCCTCCACCTCCCTGGA GGGA 5: 4,755,824 probably benign Het
Gsk3a A T 7: 25,233,854 Y177N probably damaging Het
Haus5 T C 7: 30,659,572 T222A probably benign Het
Igfbp7 G T 5: 77,401,490 Q189K probably benign Het
Inppl1 A T 7: 101,827,456 Y771* probably null Het
Iqck A T 7: 118,915,591 Y234F probably damaging Het
Irs1 G T 1: 82,290,098 C132* probably null Het
Jmjd1c T G 10: 67,219,632 V277G probably benign Het
Klhl22 G A 16: 17,792,750 V622M probably damaging Het
Kri1 C T 9: 21,279,432 E378K Het
Lilra6 C T 7: 3,913,197 G221D probably damaging Het
Marc1 A G 1: 184,795,240 L297P probably damaging Het
Mecom T C 3: 29,980,954 E191G probably damaging Het
Mgrn1 T A 16: 4,927,664 probably null Het
Mical1 C T 10: 41,479,210 probably null Het
Mlxipl T C 5: 135,134,030 Y711H possibly damaging Het
Mpl T A 4: 118,444,063 H535L Het
Mtfr2 C A 10: 20,352,920 H71N probably benign Het
Mtrf1 GCCTTC GC 14: 79,423,491 probably null Het
Myh15 A G 16: 49,171,909 Q1582R possibly damaging Het
Neb C T 2: 52,177,623 E6062K possibly damaging Het
Nlrp4c G A 7: 6,060,793 A67T probably damaging Het
Noc3l T A 19: 38,812,345 H231L probably benign Het
Odf1 T C 15: 38,219,559 Y44H possibly damaging Het
Olfr1052 C T 2: 86,298,677 P287L probably benign Het
Olfr589 G A 7: 103,155,330 T139I probably damaging Het
Olfr591 C T 7: 103,173,046 R197H probably benign Het
Otol1 G T 3: 70,018,694 E67D probably benign Het
Otud7b A G 3: 96,155,237 S598G probably benign Het
Ppwd1 T A 13: 104,205,626 T607S probably benign Het
Prag1 A G 8: 36,102,560 N99S probably benign Het
Ralgds C A 2: 28,549,308 Q737K possibly damaging Het
Scyl2 T C 10: 89,669,687 H98R probably damaging Het
Secisbp2 A C 13: 51,677,254 Q575H probably benign Het
Slc9a5 A T 8: 105,357,636 H497L probably benign Het
Sufu T A 19: 46,475,588 V414E probably damaging Het
Tbc1d22b A T 17: 29,599,869 E399V probably damaging Het
Tcp10c G A 17: 13,355,934 V59I probably benign Het
Tdpoz3 T C 3: 93,827,061 S348P probably benign Het
Tmem219 A T 7: 126,891,756 F176L probably damaging Het
Trav6-2 A G 14: 52,667,834 D104G probably damaging Het
Uba7 A G 9: 107,983,339 K927R probably benign Het
Vps54 T G 11: 21,271,720 D158E probably benign Het
Xpnpep1 C T 19: 53,011,765 probably null Het
Xpo7 G A 14: 70,704,706 R73W probably damaging Het
Zfp532 A T 18: 65,682,898 M781L probably benign Het
Zfp930 T A 8: 69,228,541 I295K probably benign Het
Other mutations in Dpy19l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Dpy19l2 APN 9 24582818 missense probably damaging 1.00
IGL01137:Dpy19l2 APN 9 24658562 missense possibly damaging 0.78
IGL01586:Dpy19l2 APN 9 24666975 missense probably benign 0.16
IGL02245:Dpy19l2 APN 9 24696025 missense probably benign
IGL02507:Dpy19l2 APN 9 24631267 missense probably benign 0.01
IGL02541:Dpy19l2 APN 9 24658647 missense probably benign 0.00
IGL02644:Dpy19l2 APN 9 24658592 missense probably damaging 1.00
IGL03144:Dpy19l2 APN 9 24646307 missense possibly damaging 0.92
Deferential UTSW 9 24695814 missense probably benign 0.41
polite UTSW 9 24660743 missense possibly damaging 0.91
BB004:Dpy19l2 UTSW 9 24695901 missense probably benign 0.00
BB014:Dpy19l2 UTSW 9 24695901 missense probably benign 0.00
R0022:Dpy19l2 UTSW 9 24696124 missense probably benign
R0029:Dpy19l2 UTSW 9 24558101 missense probably damaging 0.97
R0066:Dpy19l2 UTSW 9 24646383 splice site probably benign
R0066:Dpy19l2 UTSW 9 24646383 splice site probably benign
R0089:Dpy19l2 UTSW 9 24695793 missense probably benign 0.01
R0240:Dpy19l2 UTSW 9 24658580 missense probably damaging 1.00
R0240:Dpy19l2 UTSW 9 24658580 missense probably damaging 1.00
R0349:Dpy19l2 UTSW 9 24695922 missense possibly damaging 0.89
R0491:Dpy19l2 UTSW 9 24696028 missense probably benign 0.09
R0519:Dpy19l2 UTSW 9 24558095 missense probably benign 0.30
R1398:Dpy19l2 UTSW 9 24581263 splice site probably benign
R1465:Dpy19l2 UTSW 9 24669322 missense probably benign 0.04
R1465:Dpy19l2 UTSW 9 24669322 missense probably benign 0.04
R1576:Dpy19l2 UTSW 9 24584502 missense probably benign
R1606:Dpy19l2 UTSW 9 24581215 missense probably benign
R2157:Dpy19l2 UTSW 9 24584632 missense probably benign 0.00
R2157:Dpy19l2 UTSW 9 24680780 missense probably benign 0.02
R2402:Dpy19l2 UTSW 9 24581248 missense probably damaging 1.00
R2409:Dpy19l2 UTSW 9 24658628 missense probably benign 0.00
R3196:Dpy19l2 UTSW 9 24695989 missense probably damaging 1.00
R3419:Dpy19l2 UTSW 9 24581205 missense probably damaging 1.00
R4884:Dpy19l2 UTSW 9 24628180 nonsense probably null
R5289:Dpy19l2 UTSW 9 24695997 missense probably benign
R5950:Dpy19l2 UTSW 9 24581134 missense probably benign 0.10
R6470:Dpy19l2 UTSW 9 24660743 missense possibly damaging 0.91
R7028:Dpy19l2 UTSW 9 24628251 missense probably benign 0.15
R7051:Dpy19l2 UTSW 9 24584493 missense probably benign 0.00
R7649:Dpy19l2 UTSW 9 24696163 start codon destroyed probably null 0.53
R7927:Dpy19l2 UTSW 9 24695901 missense probably benign 0.00
R7936:Dpy19l2 UTSW 9 24558158 missense probably damaging 1.00
R8076:Dpy19l2 UTSW 9 24680692 missense probably damaging 1.00
R8259:Dpy19l2 UTSW 9 24669406 missense probably benign 0.08
X0067:Dpy19l2 UTSW 9 24585537 missense probably benign 0.00
Z1088:Dpy19l2 UTSW 9 24660824 splice site probably null
Z1177:Dpy19l2 UTSW 9 24646359 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TAGAAGTCTGAGAATTCCTGGC -3'
(R):5'- TGCAGCATTTCCTCCTAGGC -3'

Sequencing Primer
(F):5'- GAGAATTCCTGGCATGCAATTCTCAG -3'
(R):5'- ATTTCCTCCTAGGCGGCAG -3'
Posted On2019-05-15