Mutagenetix > Incidental Mutation

Incidental Mutation 'R7095:Mtrf1'

550448

Institutional Source

Beutler Lab

Gene Symbol

Mtrf1

Ensembl Gene

ENSMUSG00000022022

Gene Name

mitochondrial translational release factor 1

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.095) question?

Stock #

R7095 (G1)

Quality Score

217.468

Status

Validated

Chromosome

Chromosomal Location

79397772-79423587 bp(+) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

GCCTTC to GC at 79423491 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000022600 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022600] [ENSMUST00000061222]

AlphaFold

Q8K126

Predicted Effect

probably null
Transcript: ENSMUST00000022600

SMART Domains

Protein: ENSMUSP00000022600
Gene: ENSMUSG00000022022

Domain	Start	End	E-Value	Type
low complexity region	104	119	N/A	INTRINSIC
low complexity region	122	133	N/A	INTRINSIC
PCRF	139	255	5.96e-27	SMART
Pfam:RF-1	290	400	2.6e-41	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000061222

SMART Domains

Protein: ENSMUSP00000060768
Gene: ENSMUSG00000043881

Domain	Start	End	E-Value	Type
Blast:BTB	11	44	2e-11	BLAST
BTB	63	168	1.05e-23	SMART
BACK	173	279	1.41e-19	SMART
low complexity region	317	340	N/A	INTRINSIC
Pfam:Kelch_1	434	481	1.7e-9	PFAM
low complexity region	657	676	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

99% (71/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was determined by in silico methods to be a mitochondrial protein with similarity to the peptide chain release factors (RFs) discovered in bacteria and yeast. The peptide chain release factors direct the termination of translation in response to the peptide chain termination codons. Initially thought to have a role in the termination of mitochondria protein synthesis, a recent publication found no mitochondrial translation release functionality. Multiple alternatively spliced transcript variants have been suggested by mRNA and EST data; however, their full-length natures are not clear. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcf1	A	G	17: 35,957,511	V809A	possibly damaging	Het
Adam32	T	A	8: 24,914,070	D242V	probably damaging	Het
Adamts9	T	A	6: 92,887,691	H763L	probably benign	Het
Aff1	A	G	5: 103,843,085	D967G	probably damaging	Het
Anpep	A	T	7: 79,842,202	L17Q	possibly damaging	Het
Appbp2	G	T	11: 85,234,727	S28*	probably null	Het
Bach1	G	A	16: 87,719,291	R240Q	probably benign	Het
Bod1l	A	G	5: 41,795,068		probably null	Het
Capn5	G	A	7: 98,125,831	T534I	probably benign	Het
Cbx2	T	C	11: 119,028,059	I150T	probably damaging	Het
Cdh11	A	G	8: 102,658,267	V392A	probably damaging	Het
Cenpf	A	T	1: 189,659,176	C803S	probably benign	Het
Cep135	A	G	5: 76,594,058	T114A	probably benign	Het
Chd2	A	T	7: 73,471,881	D994E	probably damaging	Het
Chtf18	C	A	17: 25,722,678	W584C	probably damaging	Het
Dclk2	C	T	3: 86,793,259	R638H	probably damaging	Het
Dgkh	C	A	14: 78,627,784	M172I	probably benign	Het
Dpy19l2	T	G	9: 24,695,814	H117P	probably benign	Het
Dzip3	A	T	16: 48,927,790	N908K	probably benign	Het
Erc2	A	T	14: 27,898,593	N393Y	probably damaging	Het
Fam118b	T	C	9: 35,221,490	E291G	possibly damaging	Het
Fam193a	C	T	5: 34,458,034	L816F	probably damaging	Het
Fat2	A	G	11: 55,311,331	Y306H	probably damaging	Het
Fndc10	C	T	4: 155,695,117	T206I	probably damaging	Het
Fzd1	GGGACTCCTCCACCTCCCTGGA	GGGA	5: 4,755,824		probably benign	Het
Gsk3a	A	T	7: 25,233,854	Y177N	probably damaging	Het
Haus5	T	C	7: 30,659,572	T222A	probably benign	Het
Igfbp7	G	T	5: 77,401,490	Q189K	probably benign	Het
Inppl1	A	T	7: 101,827,456	Y771*	probably null	Het
Iqck	A	T	7: 118,915,591	Y234F	probably damaging	Het
Irs1	G	T	1: 82,290,098	C132*	probably null	Het
Jmjd1c	T	G	10: 67,219,632	V277G	probably benign	Het
Klhl22	G	A	16: 17,792,750	V622M	probably damaging	Het
Kri1	C	T	9: 21,279,432	E378K		Het
Lilra6	C	T	7: 3,913,197	G221D	probably damaging	Het
Marc1	A	G	1: 184,795,240	L297P	probably damaging	Het
Mecom	T	C	3: 29,980,954	E191G	probably damaging	Het
Mgrn1	T	A	16: 4,927,664		probably null	Het
Mical1	C	T	10: 41,479,210		probably null	Het
Mlxipl	T	C	5: 135,134,030	Y711H	possibly damaging	Het
Mpl	T	A	4: 118,444,063	H535L		Het
Mtfr2	C	A	10: 20,352,920	H71N	probably benign	Het
Myh15	A	G	16: 49,171,909	Q1582R	possibly damaging	Het
Neb	C	T	2: 52,177,623	E6062K	possibly damaging	Het
Nlrp4c	G	A	7: 6,060,793	A67T	probably damaging	Het
Noc3l	T	A	19: 38,812,345	H231L	probably benign	Het
Odf1	T	C	15: 38,219,559	Y44H	possibly damaging	Het
Olfr1052	C	T	2: 86,298,677	P287L	probably benign	Het
Olfr589	G	A	7: 103,155,330	T139I	probably damaging	Het
Olfr591	C	T	7: 103,173,046	R197H	probably benign	Het
Otol1	G	T	3: 70,018,694	E67D	probably benign	Het
Otud7b	A	G	3: 96,155,237	S598G	probably benign	Het
Ppwd1	T	A	13: 104,205,626	T607S	probably benign	Het
Prag1	A	G	8: 36,102,560	N99S	probably benign	Het
Ralgds	C	A	2: 28,549,308	Q737K	possibly damaging	Het
Scyl2	T	C	10: 89,669,687	H98R	probably damaging	Het
Secisbp2	A	C	13: 51,677,254	Q575H	probably benign	Het
Slc9a5	A	T	8: 105,357,636	H497L	probably benign	Het
Sufu	T	A	19: 46,475,588	V414E	probably damaging	Het
Tbc1d22b	A	T	17: 29,599,869	E399V	probably damaging	Het
Tcp10c	G	A	17: 13,355,934	V59I	probably benign	Het
Tdpoz3	T	C	3: 93,827,061	S348P	probably benign	Het
Tmem219	A	T	7: 126,891,756	F176L	probably damaging	Het
Trav6-2	A	G	14: 52,667,834	D104G	probably damaging	Het
Uba7	A	G	9: 107,983,339	K927R	probably benign	Het
Vps54	T	G	11: 21,271,720	D158E	probably benign	Het
Xpnpep1	C	T	19: 53,011,765		probably null	Het
Xpo7	G	A	14: 70,704,706	R73W	probably damaging	Het
Zfp532	A	T	18: 65,682,898	M781L	probably benign	Het
Zfp930	T	A	8: 69,228,541	I295K	probably benign	Het

Other mutations in Mtrf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01356:Mtrf1	APN	14	79423425	missense	probably benign	0.10
IGL01478:Mtrf1	APN	14	79402920	splice site	probably benign
IGL01866:Mtrf1	APN	14	79401508	missense	probably benign
IGL02290:Mtrf1	APN	14	79401811	nonsense	probably null
IGL02929:Mtrf1	APN	14	79402833	missense	probably benign	0.00
IGL03342:Mtrf1	APN	14	79415980	missense	possibly damaging	0.80
IGL03342:Mtrf1	APN	14	79415871	splice site	probably benign
IGL03342:Mtrf1	APN	14	79415872	splice site	probably null
R0212:Mtrf1	UTSW	14	79419279	missense	probably benign	0.02
R0560:Mtrf1	UTSW	14	79406850	missense	probably damaging	1.00
R0604:Mtrf1	UTSW	14	79415887	missense	possibly damaging	0.92
R0669:Mtrf1	UTSW	14	79419268	nonsense	probably null
R0981:Mtrf1	UTSW	14	79401590	missense	probably benign	0.04
R1837:Mtrf1	UTSW	14	79401833	missense	possibly damaging	0.89
R1969:Mtrf1	UTSW	14	79401671	missense	probably damaging	1.00
R3883:Mtrf1	UTSW	14	79419267	missense	probably damaging	1.00
R4739:Mtrf1	UTSW	14	79413080	missense	probably damaging	1.00
R4748:Mtrf1	UTSW	14	79411650	missense	probably damaging	1.00
R4780:Mtrf1	UTSW	14	79401688	missense	probably benign	0.02
R4965:Mtrf1	UTSW	14	79406587	missense	probably benign
R5616:Mtrf1	UTSW	14	79401445	missense	possibly damaging	0.68
R6530:Mtrf1	UTSW	14	79402891	missense	possibly damaging	0.89
R6776:Mtrf1	UTSW	14	79413081	missense	probably damaging	1.00
R7182:Mtrf1	UTSW	14	79423464	missense	possibly damaging	0.60
R7254:Mtrf1	UTSW	14	79423491	frame shift	probably null
R7871:Mtrf1	UTSW	14	79406938	missense	probably benign	0.19
R8249:Mtrf1	UTSW	14	79401479	missense	probably benign	0.23
R9593:Mtrf1	UTSW	14	79419224	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TCCTTCAGTTCCATTGGGAGAC -3'
(R):5'- GGAGAGCTGGATTATTTACTGAAAC -3'

Sequencing Primer
(F):5'- AGGCCTAATGTTTACCACATGGG -3'
(R):5'- ACTCTGTAGGCACATCTATA -3'

Posted On

2019-05-15