Incidental Mutation 'R7095:Dzip3'
ID550451
Institutional Source Beutler Lab
Gene Symbol Dzip3
Ensembl Gene ENSMUSG00000064061
Gene NameDAZ interacting protein 3, zinc finger
Synonyms2A-HUB, 6430549P11Rik, 2310047C04Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001110017.1, NM_027341.2; Ensembl: ENSMUST00000121869

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7095 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location48924232-48994165 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 48927790 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 908 (N908K)
Ref Sequence ENSEMBL: ENSMUSP00000110161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114516] [ENSMUST00000121869]
Predicted Effect probably benign
Transcript: ENSMUST00000114516
AA Change: N908K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110161
Gene: ENSMUSG00000064061
AA Change: N908K

DomainStartEndE-ValueType
low complexity region 451 472 N/A INTRINSIC
coiled coil region 548 568 N/A INTRINSIC
coiled coil region 599 650 N/A INTRINSIC
low complexity region 743 754 N/A INTRINSIC
low complexity region 883 891 N/A INTRINSIC
RING 938 977 2.09e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121869
AA Change: N1114K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113344
Gene: ENSMUSG00000064061
AA Change: N1114K

DomainStartEndE-ValueType
low complexity region 657 678 N/A INTRINSIC
coiled coil region 754 774 N/A INTRINSIC
coiled coil region 805 856 N/A INTRINSIC
low complexity region 949 960 N/A INTRINSIC
low complexity region 1089 1097 N/A INTRINSIC
RING 1144 1183 2.09e-7 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000117675
Gene: ENSMUSG00000064061
AA Change: N106K

DomainStartEndE-ValueType
low complexity region 82 90 N/A INTRINSIC
SCOP:d1ldjb_ 113 161 1e-3 SMART
Blast:RING 137 161 4e-10 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (71/72)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-indcued allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Gene trapped(23)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 A G 17: 35,957,511 V809A possibly damaging Het
Adam32 T A 8: 24,914,070 D242V probably damaging Het
Adamts9 T A 6: 92,887,691 H763L probably benign Het
Aff1 A G 5: 103,843,085 D967G probably damaging Het
Anpep A T 7: 79,842,202 L17Q possibly damaging Het
Appbp2 G T 11: 85,234,727 S28* probably null Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Bod1l A G 5: 41,795,068 probably null Het
Capn5 G A 7: 98,125,831 T534I probably benign Het
Cbx2 T C 11: 119,028,059 I150T probably damaging Het
Cdh11 A G 8: 102,658,267 V392A probably damaging Het
Cenpf A T 1: 189,659,176 C803S probably benign Het
Cep135 A G 5: 76,594,058 T114A probably benign Het
Chd2 A T 7: 73,471,881 D994E probably damaging Het
Chtf18 C A 17: 25,722,678 W584C probably damaging Het
Dclk2 C T 3: 86,793,259 R638H probably damaging Het
Dgkh C A 14: 78,627,784 M172I probably benign Het
Dpy19l2 T G 9: 24,695,814 H117P probably benign Het
Erc2 A T 14: 27,898,593 N393Y probably damaging Het
Fam118b T C 9: 35,221,490 E291G possibly damaging Het
Fam193a C T 5: 34,458,034 L816F probably damaging Het
Fat2 A G 11: 55,311,331 Y306H probably damaging Het
Fndc10 C T 4: 155,695,117 T206I probably damaging Het
Fzd1 GGGACTCCTCCACCTCCCTGGA GGGA 5: 4,755,824 probably benign Het
Gsk3a A T 7: 25,233,854 Y177N probably damaging Het
Haus5 T C 7: 30,659,572 T222A probably benign Het
Igfbp7 G T 5: 77,401,490 Q189K probably benign Het
Inppl1 A T 7: 101,827,456 Y771* probably null Het
Iqck A T 7: 118,915,591 Y234F probably damaging Het
Irs1 G T 1: 82,290,098 C132* probably null Het
Jmjd1c T G 10: 67,219,632 V277G probably benign Het
Klhl22 G A 16: 17,792,750 V622M probably damaging Het
Kri1 C T 9: 21,279,432 E378K Het
Lilra6 C T 7: 3,913,197 G221D probably damaging Het
Marc1 A G 1: 184,795,240 L297P probably damaging Het
Mecom T C 3: 29,980,954 E191G probably damaging Het
Mgrn1 T A 16: 4,927,664 probably null Het
Mical1 C T 10: 41,479,210 probably null Het
Mlxipl T C 5: 135,134,030 Y711H possibly damaging Het
Mpl T A 4: 118,444,063 H535L Het
Mtfr2 C A 10: 20,352,920 H71N probably benign Het
Mtrf1 GCCTTC GC 14: 79,423,491 probably null Het
Myh15 A G 16: 49,171,909 Q1582R possibly damaging Het
Neb C T 2: 52,177,623 E6062K possibly damaging Het
Nlrp4c G A 7: 6,060,793 A67T probably damaging Het
Noc3l T A 19: 38,812,345 H231L probably benign Het
Odf1 T C 15: 38,219,559 Y44H possibly damaging Het
Olfr1052 C T 2: 86,298,677 P287L probably benign Het
Olfr589 G A 7: 103,155,330 T139I probably damaging Het
Olfr591 C T 7: 103,173,046 R197H probably benign Het
Otol1 G T 3: 70,018,694 E67D probably benign Het
Otud7b A G 3: 96,155,237 S598G probably benign Het
Ppwd1 T A 13: 104,205,626 T607S probably benign Het
Prag1 A G 8: 36,102,560 N99S probably benign Het
Ralgds C A 2: 28,549,308 Q737K possibly damaging Het
Scyl2 T C 10: 89,669,687 H98R probably damaging Het
Secisbp2 A C 13: 51,677,254 Q575H probably benign Het
Slc9a5 A T 8: 105,357,636 H497L probably benign Het
Sufu T A 19: 46,475,588 V414E probably damaging Het
Tbc1d22b A T 17: 29,599,869 E399V probably damaging Het
Tcp10c G A 17: 13,355,934 V59I probably benign Het
Tdpoz3 T C 3: 93,827,061 S348P probably benign Het
Tmem219 A T 7: 126,891,756 F176L probably damaging Het
Trav6-2 A G 14: 52,667,834 D104G probably damaging Het
Uba7 A G 9: 107,983,339 K927R probably benign Het
Vps54 T G 11: 21,271,720 D158E probably benign Het
Xpnpep1 C T 19: 53,011,765 probably null Het
Xpo7 G A 14: 70,704,706 R73W probably damaging Het
Zfp532 A T 18: 65,682,898 M781L probably benign Het
Zfp930 T A 8: 69,228,541 I295K probably benign Het
Other mutations in Dzip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Dzip3 APN 16 48928415 missense probably damaging 1.00
IGL00931:Dzip3 APN 16 48935497 critical splice donor site probably null
IGL01109:Dzip3 APN 16 48929674 missense probably benign 0.27
IGL01121:Dzip3 APN 16 48944881 missense probably benign 0.10
IGL01328:Dzip3 APN 16 48972258 missense probably damaging 1.00
IGL01729:Dzip3 APN 16 48928363 missense possibly damaging 0.78
IGL02044:Dzip3 APN 16 48948427 missense possibly damaging 0.90
IGL02051:Dzip3 APN 16 48972254 missense probably benign 0.01
IGL02115:Dzip3 APN 16 48948485 missense probably benign 0.00
IGL02125:Dzip3 APN 16 48927596 missense probably damaging 1.00
IGL02136:Dzip3 APN 16 48927582 missense possibly damaging 0.94
IGL02244:Dzip3 APN 16 48980988 missense probably benign 0.01
IGL02253:Dzip3 APN 16 48944924 missense probably benign 0.34
IGL02412:Dzip3 APN 16 48958457 missense probably benign 0.00
IGL02452:Dzip3 APN 16 48938537 splice site probably benign
IGL02481:Dzip3 APN 16 48975551 splice site probably benign
IGL02499:Dzip3 APN 16 48933850 missense probably damaging 1.00
IGL02511:Dzip3 APN 16 48936980 missense possibly damaging 0.75
IGL02519:Dzip3 APN 16 48928396 missense probably damaging 1.00
IGL02610:Dzip3 APN 16 48951653 missense probably damaging 1.00
IGL03129:Dzip3 APN 16 48942083 missense possibly damaging 0.51
IGL03342:Dzip3 APN 16 48929623 missense probably damaging 0.98
IGL03493:Dzip3 APN 16 48951696 missense probably benign 0.32
dazwick UTSW 16 48958465 missense possibly damaging 0.90
1mM(1):Dzip3 UTSW 16 48951557 missense probably damaging 1.00
PIT4651001:Dzip3 UTSW 16 48944878 missense probably benign
R0313:Dzip3 UTSW 16 48937061 missense probably damaging 0.99
R0483:Dzip3 UTSW 16 48947713 missense possibly damaging 0.94
R0504:Dzip3 UTSW 16 48959643 splice site probably benign
R0744:Dzip3 UTSW 16 48959675 missense probably damaging 1.00
R0800:Dzip3 UTSW 16 48953808 splice site probably benign
R0927:Dzip3 UTSW 16 48975477 missense probably damaging 0.99
R0931:Dzip3 UTSW 16 48951558 missense probably damaging 1.00
R1170:Dzip3 UTSW 16 48961208 missense probably damaging 1.00
R1203:Dzip3 UTSW 16 48951817 missense probably damaging 1.00
R1205:Dzip3 UTSW 16 48951681 missense probably damaging 1.00
R1442:Dzip3 UTSW 16 48945622 missense probably benign 0.19
R1526:Dzip3 UTSW 16 48937006 missense probably damaging 1.00
R1560:Dzip3 UTSW 16 48951540 splice site probably null
R1585:Dzip3 UTSW 16 48977878 splice site probably benign
R1682:Dzip3 UTSW 16 48958417 critical splice donor site probably null
R1957:Dzip3 UTSW 16 48927593 missense probably damaging 1.00
R2472:Dzip3 UTSW 16 48953787 missense possibly damaging 0.85
R2571:Dzip3 UTSW 16 48972218 splice site probably null
R3040:Dzip3 UTSW 16 48928324 missense probably damaging 1.00
R3081:Dzip3 UTSW 16 48927558 missense probably damaging 1.00
R3615:Dzip3 UTSW 16 48937063 missense probably damaging 1.00
R3616:Dzip3 UTSW 16 48937063 missense probably damaging 1.00
R3786:Dzip3 UTSW 16 48975543 missense probably benign 0.08
R3851:Dzip3 UTSW 16 48950013 missense possibly damaging 0.94
R4097:Dzip3 UTSW 16 48958489 nonsense probably null
R4371:Dzip3 UTSW 16 48943455 critical splice donor site probably null
R4612:Dzip3 UTSW 16 48952040 nonsense probably null
R4671:Dzip3 UTSW 16 48979590 nonsense probably null
R4695:Dzip3 UTSW 16 48951561 missense probably damaging 1.00
R4696:Dzip3 UTSW 16 48925969 unclassified probably benign
R4769:Dzip3 UTSW 16 48938474 missense probably damaging 0.97
R5063:Dzip3 UTSW 16 48953754 nonsense probably null
R5321:Dzip3 UTSW 16 48957675 missense possibly damaging 0.95
R5764:Dzip3 UTSW 16 48927361 intron probably benign
R6020:Dzip3 UTSW 16 48951842 missense probably damaging 1.00
R6218:Dzip3 UTSW 16 48958465 missense possibly damaging 0.90
R6300:Dzip3 UTSW 16 48951807 missense probably damaging 1.00
R6365:Dzip3 UTSW 16 48931273 missense probably damaging 0.96
R6778:Dzip3 UTSW 16 48982083 missense probably benign 0.00
R6915:Dzip3 UTSW 16 48942125 missense possibly damaging 0.72
R7047:Dzip3 UTSW 16 48982126 missense probably benign 0.04
R7059:Dzip3 UTSW 16 48980942 missense probably benign 0.34
R7227:Dzip3 UTSW 16 48951569 missense probably damaging 0.99
R7319:Dzip3 UTSW 16 48927540 critical splice donor site probably null
R7436:Dzip3 UTSW 16 48951989 missense probably damaging 1.00
R7469:Dzip3 UTSW 16 48944879 missense probably benign
R7526:Dzip3 UTSW 16 48975474 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTCATGACAGATTACACAAGGC -3'
(R):5'- TAGCTCTAAGAAATACTGCCAGC -3'

Sequencing Primer
(F):5'- TGACAGATTACACAAGGCTCCTCTTC -3'
(R):5'- GCTACAACCTATTCAGTTCT -3'
Posted On2019-05-15