Incidental Mutation 'R7095:Abcf1'
Institutional Source Beutler Lab
Gene Symbol Abcf1
Ensembl Gene ENSMUSG00000038762
Gene NameATP-binding cassette, sub-family F (GCN20), member 1
SynonymsGCN20, D17Wsu166e, Abc50
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R7095 (G1)
Quality Score225.009
Status Validated
Chromosomal Location35956819-35969761 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35957511 bp
Amino Acid Change Valine to Alanine at position 809 (V809A)
Ref Sequence ENSEMBL: ENSMUSP00000036881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043757]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043757
AA Change: V809A

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000036881
Gene: ENSMUSG00000038762
AA Change: V809A

low complexity region 2 13 N/A INTRINSIC
low complexity region 25 40 N/A INTRINSIC
coiled coil region 46 79 N/A INTRINSIC
low complexity region 173 208 N/A INTRINSIC
low complexity region 218 234 N/A INTRINSIC
low complexity region 247 255 N/A INTRINSIC
AAA 320 524 9e-10 SMART
low complexity region 529 554 N/A INTRINSIC
low complexity region 607 615 N/A INTRINSIC
AAA 642 807 1.11e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the GCN20 subfamily. Unlike other members of the superfamily, this protein lacks the transmembrane domains which are characteristic of most ABC transporters. This protein may be regulated by tumor necrosis factor-alpha and play a role in enhancement of protein synthesis and the inflammation process. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display lethality shortly after implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 T A 8: 24,914,070 D242V probably damaging Het
Adamts9 T A 6: 92,887,691 H763L probably benign Het
Aff1 A G 5: 103,843,085 D967G probably damaging Het
Anpep A T 7: 79,842,202 L17Q possibly damaging Het
Appbp2 G T 11: 85,234,727 S28* probably null Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Bod1l A G 5: 41,795,068 probably null Het
Capn5 G A 7: 98,125,831 T534I probably benign Het
Cbx2 T C 11: 119,028,059 I150T probably damaging Het
Cdh11 A G 8: 102,658,267 V392A probably damaging Het
Cenpf A T 1: 189,659,176 C803S probably benign Het
Cep135 A G 5: 76,594,058 T114A probably benign Het
Chd2 A T 7: 73,471,881 D994E probably damaging Het
Chtf18 C A 17: 25,722,678 W584C probably damaging Het
Dclk2 C T 3: 86,793,259 R638H probably damaging Het
Dgkh C A 14: 78,627,784 M172I probably benign Het
Dpy19l2 T G 9: 24,695,814 H117P probably benign Het
Dzip3 A T 16: 48,927,790 N908K probably benign Het
Erc2 A T 14: 27,898,593 N393Y probably damaging Het
Fam118b T C 9: 35,221,490 E291G possibly damaging Het
Fam193a C T 5: 34,458,034 L816F probably damaging Het
Fat2 A G 11: 55,311,331 Y306H probably damaging Het
Fndc10 C T 4: 155,695,117 T206I probably damaging Het
Fzd1 GGGACTCCTCCACCTCCCTGGA GGGA 5: 4,755,824 probably benign Het
Gsk3a A T 7: 25,233,854 Y177N probably damaging Het
Haus5 T C 7: 30,659,572 T222A probably benign Het
Igfbp7 G T 5: 77,401,490 Q189K probably benign Het
Inppl1 A T 7: 101,827,456 Y771* probably null Het
Iqck A T 7: 118,915,591 Y234F probably damaging Het
Irs1 G T 1: 82,290,098 C132* probably null Het
Jmjd1c T G 10: 67,219,632 V277G probably benign Het
Klhl22 G A 16: 17,792,750 V622M probably damaging Het
Kri1 C T 9: 21,279,432 E378K Het
Lilra6 C T 7: 3,913,197 G221D probably damaging Het
Marc1 A G 1: 184,795,240 L297P probably damaging Het
Mecom T C 3: 29,980,954 E191G probably damaging Het
Mgrn1 T A 16: 4,927,664 probably null Het
Mical1 C T 10: 41,479,210 probably null Het
Mlxipl T C 5: 135,134,030 Y711H possibly damaging Het
Mpl T A 4: 118,444,063 H535L Het
Mtfr2 C A 10: 20,352,920 H71N probably benign Het
Mtrf1 GCCTTC GC 14: 79,423,491 probably null Het
Myh15 A G 16: 49,171,909 Q1582R possibly damaging Het
Neb C T 2: 52,177,623 E6062K possibly damaging Het
Nlrp4c G A 7: 6,060,793 A67T probably damaging Het
Noc3l T A 19: 38,812,345 H231L probably benign Het
Odf1 T C 15: 38,219,559 Y44H possibly damaging Het
Olfr1052 C T 2: 86,298,677 P287L probably benign Het
Olfr589 G A 7: 103,155,330 T139I probably damaging Het
Olfr591 C T 7: 103,173,046 R197H probably benign Het
Otol1 G T 3: 70,018,694 E67D probably benign Het
Otud7b A G 3: 96,155,237 S598G probably benign Het
Ppwd1 T A 13: 104,205,626 T607S probably benign Het
Prag1 A G 8: 36,102,560 N99S probably benign Het
Ralgds C A 2: 28,549,308 Q737K possibly damaging Het
Scyl2 T C 10: 89,669,687 H98R probably damaging Het
Secisbp2 A C 13: 51,677,254 Q575H probably benign Het
Slc9a5 A T 8: 105,357,636 H497L probably benign Het
Sufu T A 19: 46,475,588 V414E probably damaging Het
Tbc1d22b A T 17: 29,599,869 E399V probably damaging Het
Tcp10c G A 17: 13,355,934 V59I probably benign Het
Tdpoz3 T C 3: 93,827,061 S348P probably benign Het
Tmem219 A T 7: 126,891,756 F176L probably damaging Het
Trav6-2 A G 14: 52,667,834 D104G probably damaging Het
Uba7 A G 9: 107,983,339 K927R probably benign Het
Vps54 T G 11: 21,271,720 D158E probably benign Het
Xpnpep1 C T 19: 53,011,765 probably null Het
Xpo7 G A 14: 70,704,706 R73W probably damaging Het
Zfp532 A T 18: 65,682,898 M781L probably benign Het
Zfp930 T A 8: 69,228,541 I295K probably benign Het
Other mutations in Abcf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01405:Abcf1 APN 17 35964010 missense probably damaging 1.00
IGL02008:Abcf1 APN 17 35962062 missense probably benign
IGL02209:Abcf1 APN 17 35964009 missense probably damaging 0.99
IGL02218:Abcf1 APN 17 35958338 missense probably benign 0.00
IGL02455:Abcf1 APN 17 35960129 missense probably damaging 1.00
IGL03238:Abcf1 APN 17 35963323 missense probably damaging 0.99
bamboo UTSW 17 35958062 splice site probably benign
IGL02837:Abcf1 UTSW 17 35957581 missense probably benign
R0007:Abcf1 UTSW 17 35959670 missense probably damaging 0.99
R0078:Abcf1 UTSW 17 35958062 splice site probably benign
R0617:Abcf1 UTSW 17 35961187 missense probably benign 0.00
R0655:Abcf1 UTSW 17 35957845 missense probably benign 0.20
R1421:Abcf1 UTSW 17 35960909 missense probably damaging 1.00
R1879:Abcf1 UTSW 17 35961812 missense probably benign 0.13
R3433:Abcf1 UTSW 17 35958217 missense probably benign 0.36
R3915:Abcf1 UTSW 17 35959510 missense possibly damaging 0.46
R4056:Abcf1 UTSW 17 35959915 missense possibly damaging 0.90
R4057:Abcf1 UTSW 17 35959915 missense possibly damaging 0.90
R4114:Abcf1 UTSW 17 35959254 missense probably benign 0.25
R4709:Abcf1 UTSW 17 35960177 missense probably damaging 1.00
R4722:Abcf1 UTSW 17 35958041 intron probably benign
R4932:Abcf1 UTSW 17 35959450 missense possibly damaging 0.62
R5129:Abcf1 UTSW 17 35960795 unclassified probably benign
R5255:Abcf1 UTSW 17 35959737 splice site probably null
R5517:Abcf1 UTSW 17 35958341 missense possibly damaging 0.48
R5518:Abcf1 UTSW 17 35958341 missense possibly damaging 0.48
R5660:Abcf1 UTSW 17 35963647 missense possibly damaging 0.87
R5836:Abcf1 UTSW 17 35962026 missense possibly damaging 0.77
R6193:Abcf1 UTSW 17 35963572 missense possibly damaging 0.77
R6247:Abcf1 UTSW 17 35961064 missense probably damaging 1.00
R6257:Abcf1 UTSW 17 35961182 missense probably benign 0.10
R6876:Abcf1 UTSW 17 35959244 missense probably benign 0.45
R7134:Abcf1 UTSW 17 35959252 missense possibly damaging 0.90
R7475:Abcf1 UTSW 17 35963567 critical splice donor site probably null
R7843:Abcf1 UTSW 17 35959243 missense possibly damaging 0.89
R7867:Abcf1 UTSW 17 35961998 missense probably damaging 0.99
R8228:Abcf1 UTSW 17 35961041 critical splice donor site probably null
RF037:Abcf1 UTSW 17 35963188 unclassified probably benign
RF038:Abcf1 UTSW 17 35963201 unclassified probably benign
RF041:Abcf1 UTSW 17 35963201 unclassified probably benign
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-05-15