Incidental Mutation 'R7096:Csmd2'
ID550472
Institutional Source Beutler Lab
Gene Symbol Csmd2
Ensembl Gene ENSMUSG00000028804
Gene NameCUB and Sushi multiple domains 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R7096 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location127987857-128567656 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 128462726 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 1608 (S1608L)
Ref Sequence ENSEMBL: ENSMUSP00000138958 (fasta)
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (68/70)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd18 T G 3: 40,933,870 M383R probably damaging Het
Acd T A 8: 105,698,489 E366V possibly damaging Het
Acvr2b T A 9: 119,428,189 probably null Het
Alg10b C T 15: 90,227,361 T136I probably benign Het
Ankrd42 T A 7: 92,591,832 K440* probably null Het
Apc T A 18: 34,315,957 S1969T probably damaging Het
Arhgef25 T C 10: 127,184,028 Y447C probably damaging Het
AW146154 G A 7: 41,481,443 A83V probably benign Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Barhl1 T G 2: 28,909,714 I300L probably benign Het
Brd1 C A 15: 88,713,935 R536L probably damaging Het
Brms1 T A 19: 5,046,680 I130N probably damaging Het
Ccdc68 A G 18: 69,940,170 H63R probably damaging Het
Ccl28 A G 13: 119,650,893 I74V probably benign Het
Cd300ld T A 11: 114,987,495 I64F possibly damaging Het
Cdkl2 G A 5: 92,033,184 Q199* probably null Het
Cdkn2c C T 4: 109,661,358 R133Q probably benign Het
Coq2 A G 5: 100,663,720 probably benign Het
Coq6 T C 12: 84,361,821 probably null Het
Cyp11b2 T A 15: 74,855,988 R82W probably damaging Het
Cyp2d10 T C 15: 82,405,261 T217A probably benign Het
Dclk2 C T 3: 86,793,259 R638H probably damaging Het
Dnah7a T C 1: 53,483,440 I2880V possibly damaging Het
Dync1h1 C A 12: 110,657,078 T3595K probably damaging Het
Ecscr T A 18: 35,715,425 E183V probably damaging Het
Elovl6 A G 3: 129,605,106 N52S probably benign Het
Eps8l1 G T 7: 4,474,191 A455S probably benign Het
Gpat2 A G 2: 127,428,289 N74S probably benign Het
Gstk1 C A 6: 42,249,473 T172K probably damaging Het
Gtf3c1 T C 7: 125,696,559 probably null Het
Gucy2c T C 6: 136,728,341 D532G probably benign Het
Hoxc12 T A 15: 102,937,038 N62K possibly damaging Het
Hsdl1 C A 8: 119,566,325 A124S possibly damaging Het
Il11 T C 7: 4,775,996 Y45C probably damaging Het
Lcat C T 8: 105,939,677 M404I possibly damaging Het
Ldhb A G 6: 142,501,373 F72L probably benign Het
Map10 T C 8: 125,671,923 L685P probably damaging Het
Me2 A G 18: 73,794,890 V174A probably benign Het
Med13l C A 5: 118,721,926 Q328K possibly damaging Het
Mta2 A T 19: 8,947,775 I336F probably damaging Het
Mterf1a A T 5: 3,891,769 I33N probably damaging Het
Myo15b T A 11: 115,891,498 probably null Het
Myof C A 19: 37,936,200 G1215V probably damaging Het
Nlgn2 G A 11: 69,825,690 T675M probably damaging Het
Olfr385 T A 11: 73,589,637 M34L probably benign Het
Olfr485 C A 7: 108,159,641 M77I probably benign Het
Olfr768 T C 10: 129,093,846 I43V probably damaging Het
Padi3 T C 4: 140,800,124 D122G probably damaging Het
Pcnx3 G A 19: 5,672,615 R1350C probably damaging Het
Pdzrn4 C A 15: 92,397,503 Q197K probably benign Het
Pitpnm2 C T 5: 124,129,261 G639S possibly damaging Het
Piwil4 T A 9: 14,736,816 K156* probably null Het
Pkmyt1 T A 17: 23,734,113 H214Q probably damaging Het
Pnpt1 G A 11: 29,154,867 R597Q probably benign Het
Poteg C A 8: 27,473,567 A344E probably benign Het
Rad21l A G 2: 151,667,920 M87T probably benign Het
Ranbp17 T C 11: 33,474,896 I487V probably benign Het
Rap1gap2 C A 11: 74,392,231 R681L probably damaging Het
Rimbp2 C A 5: 128,774,269 R871L probably damaging Het
Rnf135 T C 11: 80,189,225 V114A probably benign Het
Skiv2l T A 17: 34,841,470 H849L probably benign Het
Snai2 A G 16: 14,707,164 H178R possibly damaging Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Taar1 A T 10: 23,920,911 E169V possibly damaging Het
Tdrd12 G T 7: 35,487,589 D625E Het
Tlr6 A G 5: 64,953,776 V596A probably benign Het
Trak2 T G 1: 58,903,590 N886H probably damaging Het
Tsga10 T A 1: 37,840,614 D32V probably damaging Het
Vmn1r214 A G 13: 23,035,026 D230G probably damaging Het
Vmn2r108 A G 17: 20,462,500 L814S probably damaging Het
Zbbx T C 3: 75,081,737 D353G probably benign Het
Other mutations in Csmd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Csmd2 APN 4 128483473 missense probably benign 0.03
IGL01098:Csmd2 APN 4 128059052 missense probably damaging 0.99
IGL01114:Csmd2 APN 4 128369130 missense probably benign 0.04
IGL01364:Csmd2 APN 4 128414288 missense probably benign 0.01
IGL01530:Csmd2 APN 4 128414301 missense possibly damaging 0.66
IGL01582:Csmd2 APN 4 128563305 nonsense probably null
IGL01670:Csmd2 APN 4 128513371 splice site probably benign
IGL01707:Csmd2 APN 4 128383005 missense possibly damaging 0.81
IGL01810:Csmd2 APN 4 128480845 splice site probably benign
IGL01837:Csmd2 APN 4 128419570 missense possibly damaging 0.92
IGL01924:Csmd2 APN 4 128559947 missense unknown
IGL02013:Csmd2 APN 4 128321323 missense possibly damaging 0.47
IGL02020:Csmd2 APN 4 128559879 missense probably damaging 1.00
IGL02037:Csmd2 APN 4 128477470 splice site probably benign
IGL02303:Csmd2 APN 4 128369008 missense probably benign 0.01
IGL02317:Csmd2 APN 4 128463727 splice site probably benign
IGL02322:Csmd2 APN 4 128463727 splice site probably benign
IGL02338:Csmd2 APN 4 128395066 missense possibly damaging 0.79
IGL02412:Csmd2 APN 4 128513372 splice site probably benign
IGL02428:Csmd2 APN 4 128474816 missense possibly damaging 0.82
IGL02491:Csmd2 APN 4 128534257 missense probably benign
IGL02701:Csmd2 APN 4 128496141 missense probably benign 0.17
IGL02801:Csmd2 APN 4 128552075 splice site probably null
IGL02818:Csmd2 APN 4 128209728 missense probably damaging 1.00
IGL02863:Csmd2 APN 4 128521884 missense probably benign 0.00
IGL02876:Csmd2 APN 4 128321335 nonsense probably null
IGL02977:Csmd2 APN 4 128493276 nonsense probably null
IGL03006:Csmd2 APN 4 128480765 splice site probably benign
IGL03032:Csmd2 APN 4 128519041 missense probably benign 0.03
IGL03148:Csmd2 APN 4 128384269 missense probably damaging 1.00
IGL03157:Csmd2 APN 4 128414299 nonsense probably null
IGL03245:Csmd2 APN 4 128509122 missense probably benign 0.12
IGL03376:Csmd2 APN 4 128517671 missense probably benign 0.03
IGL03014:Csmd2 UTSW 4 128296429 missense probably benign 0.01
R0109:Csmd2 UTSW 4 128544743 missense probably benign 0.03
R0112:Csmd2 UTSW 4 128496029 missense probably damaging 1.00
R0157:Csmd2 UTSW 4 128521911 missense probably benign 0.02
R0390:Csmd2 UTSW 4 128133673 intron probably benign
R0441:Csmd2 UTSW 4 128520230 missense probably benign 0.00
R0519:Csmd2 UTSW 4 128487005 missense possibly damaging 0.95
R0743:Csmd2 UTSW 4 128113676 missense probably benign 0.00
R0746:Csmd2 UTSW 4 128414297 missense probably damaging 1.00
R0973:Csmd2 UTSW 4 128496188 missense possibly damaging 0.91
R1019:Csmd2 UTSW 4 128522014 missense probably benign 0.00
R1476:Csmd2 UTSW 4 128487001 missense probably benign 0.08
R1641:Csmd2 UTSW 4 128483395 missense possibly damaging 0.68
R1709:Csmd2 UTSW 4 128496195 missense probably damaging 0.96
R2866:Csmd2 UTSW 4 128414392 critical splice donor site probably null
R2870:Csmd2 UTSW 4 128557718 missense unknown
R2870:Csmd2 UTSW 4 128557718 missense unknown
R2871:Csmd2 UTSW 4 128557718 missense unknown
R2871:Csmd2 UTSW 4 128557718 missense unknown
R2872:Csmd2 UTSW 4 128557718 missense unknown
R2872:Csmd2 UTSW 4 128557718 missense unknown
R2873:Csmd2 UTSW 4 128557718 missense unknown
R2893:Csmd2 UTSW 4 128538993 intron probably null
R3796:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3797:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3798:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3914:Csmd2 UTSW 4 128321324 missense probably benign 0.07
R4198:Csmd2 UTSW 4 128510924 missense probably benign 0.07
R4489:Csmd2 UTSW 4 128381945 missense possibly damaging 0.68
R4571:Csmd2 UTSW 4 128480095 splice site probably null
R4581:Csmd2 UTSW 4 128369088 missense probably benign 0.02
R4599:Csmd2 UTSW 4 127988128 missense probably benign 0.35
R4649:Csmd2 UTSW 4 128546073 missense probably benign
R4706:Csmd2 UTSW 4 128544751 missense probably benign
R4776:Csmd2 UTSW 4 128442892 missense probably benign 0.09
R4838:Csmd2 UTSW 4 128517749 missense probably benign
R4900:Csmd2 UTSW 4 128452525 missense probably benign 0.03
R4999:Csmd2 UTSW 4 128521930 missense probably benign 0.00
R5024:Csmd2 UTSW 4 128321348 missense possibly damaging 0.94
R5034:Csmd2 UTSW 4 128059108 missense probably damaging 0.98
R5152:Csmd2 UTSW 4 128552035 missense probably benign 0.27
R5172:Csmd2 UTSW 4 128477397 missense probably benign 0.10
R5231:Csmd2 UTSW 4 128546049 missense probably benign 0.00
R5279:Csmd2 UTSW 4 128456914 missense probably benign 0.30
R5287:Csmd2 UTSW 4 128486884 missense probably benign 0.01
R5403:Csmd2 UTSW 4 128486884 missense probably benign 0.01
R5410:Csmd2 UTSW 4 128548819 missense probably benign
R5551:Csmd2 UTSW 4 128510948 missense possibly damaging 0.83
R5566:Csmd2 UTSW 4 128462889 critical splice donor site probably null
R5826:Csmd2 UTSW 4 128519199 splice site probably null
R5907:Csmd2 UTSW 4 128197385 missense probably damaging 0.99
R5913:Csmd2 UTSW 4 128551988 missense probably benign 0.01
R5970:Csmd2 UTSW 4 128546151 missense probably benign 0.00
R5977:Csmd2 UTSW 4 128059034 missense probably damaging 1.00
R6027:Csmd2 UTSW 4 128559946 missense unknown
R6075:Csmd2 UTSW 4 128486865 missense probably benign 0.15
R6129:Csmd2 UTSW 4 128493334 missense possibly damaging 0.79
R6363:Csmd2 UTSW 4 128400379 missense probably benign 0.00
R6366:Csmd2 UTSW 4 128483452 missense probably benign 0.00
R6404:Csmd2 UTSW 4 128521950 missense possibly damaging 0.90
R6437:Csmd2 UTSW 4 127988100 missense probably benign 0.24
R6441:Csmd2 UTSW 4 128394964 missense probably benign 0.03
R6643:Csmd2 UTSW 4 128372597 missense probably benign 0.14
R6724:Csmd2 UTSW 4 128563371 missense probably damaging 0.97
R6734:Csmd2 UTSW 4 128463813 missense probably benign 0.00
R6750:Csmd2 UTSW 4 128197225 missense possibly damaging 0.91
R6801:Csmd2 UTSW 4 128383950 missense probably benign 0.11
R6842:Csmd2 UTSW 4 128509159 missense possibly damaging 0.72
R6843:Csmd2 UTSW 4 128463794 missense probably benign 0.27
R6868:Csmd2 UTSW 4 128442840 missense probably benign
R6882:Csmd2 UTSW 4 128449269 missense probably benign 0.01
R7019:Csmd2 UTSW 4 128369063 missense
R7028:Csmd2 UTSW 4 128277228 missense
R7122:Csmd2 UTSW 4 128449227 missense
R7125:Csmd2 UTSW 4 128496162 missense
R7197:Csmd2 UTSW 4 128511033 missense
R7234:Csmd2 UTSW 4 128456779 missense
R7299:Csmd2 UTSW 4 128528262 missense
R7301:Csmd2 UTSW 4 128528262 missense
R7319:Csmd2 UTSW 4 128393679 missense
R7331:Csmd2 UTSW 4 128564228 splice site probably null
R7332:Csmd2 UTSW 4 128419567 missense
R7352:Csmd2 UTSW 4 128557636 missense
R7402:Csmd2 UTSW 4 128322095 missense
R7402:Csmd2 UTSW 4 128322096 missense
R7474:Csmd2 UTSW 4 128546127 missense
R7555:Csmd2 UTSW 4 128452458 missense
R7592:Csmd2 UTSW 4 128463798 missense
R7700:Csmd2 UTSW 4 128545756 intron probably null
R7714:Csmd2 UTSW 4 128382950 nonsense probably null
R7734:Csmd2 UTSW 4 128552057 missense
R7735:Csmd2 UTSW 4 128456930 critical splice donor site probably null
R7757:Csmd2 UTSW 4 128483456 missense
R7805:Csmd2 UTSW 4 128419573 missense
R7823:Csmd2 UTSW 4 128209905 missense
R7904:Csmd2 UTSW 4 128419553 missense
R7946:Csmd2 UTSW 4 128520265 missense
R7964:Csmd2 UTSW 4 128523510 missense
R7968:Csmd2 UTSW 4 128197325 missense
R8003:Csmd2 UTSW 4 128539187 nonsense probably null
R8071:Csmd2 UTSW 4 128393538 missense
Z1177:Csmd2 UTSW 4 128530797 missense
Predicted Primers PCR Primer
(F):5'- TCCTGAAGGCCACTCTCAAC -3'
(R):5'- GTATCCCTTGGCCCTTGAAC -3'

Sequencing Primer
(F):5'- TGAAGGCCACTCTCAACTTCAG -3'
(R):5'- AGGGTCCTGGCTATTCTCAC -3'
Posted On2019-05-15