Incidental Mutation 'R7096:Taar1'
ID550496
Institutional Source Beutler Lab
Gene Symbol Taar1
Ensembl Gene ENSMUSG00000056379
Gene Nametrace amine-associated receptor 1
SynonymsTrar1, Tar1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R7096 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location23920356-23921469 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23920911 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 169 (E169V)
Ref Sequence ENSEMBL: ENSMUSP00000049527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051532]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051532
AA Change: E169V

PolyPhen 2 Score 0.476 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000049527
Gene: ENSMUSG00000056379
AA Change: E169V

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 33 316 1.4e-11 PFAM
Pfam:7tm_1 39 301 2.4e-62 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G-protein coupled receptor activated by trace amines. The encoded protein responds little or not at all to dopamine, serotonin, epinephrine, or histamine, but responds well to beta-phenylethylamine, p-tyramine, octopamine, and tryptamine. While primarily functioning in neurologic systems, there is evidence that this gene is involved in blood cell and immunologic functions as well. This gene is thought to be intronless. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a null mutation display decreased prepulse inhibition and increased sensitivity to amphetamines. Mice homozygous for another knock-out allele exhibit increased sensitivity to MDMA-induced hyperthermia, brain dopamine and serotonin levels, and induced hyperactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd18 T G 3: 40,933,870 M383R probably damaging Het
Acd T A 8: 105,698,489 E366V possibly damaging Het
Acvr2b T A 9: 119,428,189 probably null Het
Alg10b C T 15: 90,227,361 T136I probably benign Het
Ankrd42 T A 7: 92,591,832 K440* probably null Het
Apc T A 18: 34,315,957 S1969T probably damaging Het
Arhgef25 T C 10: 127,184,028 Y447C probably damaging Het
AW146154 G A 7: 41,481,443 A83V probably benign Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Barhl1 T G 2: 28,909,714 I300L probably benign Het
Brd1 C A 15: 88,713,935 R536L probably damaging Het
Brms1 T A 19: 5,046,680 I130N probably damaging Het
Ccdc68 A G 18: 69,940,170 H63R probably damaging Het
Ccl28 A G 13: 119,650,893 I74V probably benign Het
Cd300ld T A 11: 114,987,495 I64F possibly damaging Het
Cdkl2 G A 5: 92,033,184 Q199* probably null Het
Cdkn2c C T 4: 109,661,358 R133Q probably benign Het
Coq2 A G 5: 100,663,720 probably benign Het
Coq6 T C 12: 84,361,821 probably null Het
Csmd2 C T 4: 128,462,726 S1608L Het
Cyp11b2 T A 15: 74,855,988 R82W probably damaging Het
Cyp2d10 T C 15: 82,405,261 T217A probably benign Het
Dclk2 C T 3: 86,793,259 R638H probably damaging Het
Dnah7a T C 1: 53,483,440 I2880V possibly damaging Het
Dync1h1 C A 12: 110,657,078 T3595K probably damaging Het
Ecscr T A 18: 35,715,425 E183V probably damaging Het
Elovl6 A G 3: 129,605,106 N52S probably benign Het
Eps8l1 G T 7: 4,474,191 A455S probably benign Het
Gpat2 A G 2: 127,428,289 N74S probably benign Het
Gstk1 C A 6: 42,249,473 T172K probably damaging Het
Gtf3c1 T C 7: 125,696,559 probably null Het
Gucy2c T C 6: 136,728,341 D532G probably benign Het
Hoxc12 T A 15: 102,937,038 N62K possibly damaging Het
Hsdl1 C A 8: 119,566,325 A124S possibly damaging Het
Il11 T C 7: 4,775,996 Y45C probably damaging Het
Lcat C T 8: 105,939,677 M404I possibly damaging Het
Ldhb A G 6: 142,501,373 F72L probably benign Het
Map10 T C 8: 125,671,923 L685P probably damaging Het
Me2 A G 18: 73,794,890 V174A probably benign Het
Med13l C A 5: 118,721,926 Q328K possibly damaging Het
Mta2 A T 19: 8,947,775 I336F probably damaging Het
Mterf1a A T 5: 3,891,769 I33N probably damaging Het
Myo15b T A 11: 115,891,498 probably null Het
Myof C A 19: 37,936,200 G1215V probably damaging Het
Nlgn2 G A 11: 69,825,690 T675M probably damaging Het
Olfr385 T A 11: 73,589,637 M34L probably benign Het
Olfr485 C A 7: 108,159,641 M77I probably benign Het
Olfr768 T C 10: 129,093,846 I43V probably damaging Het
Padi3 T C 4: 140,800,124 D122G probably damaging Het
Pcnx3 G A 19: 5,672,615 R1350C probably damaging Het
Pdzrn4 C A 15: 92,397,503 Q197K probably benign Het
Pitpnm2 C T 5: 124,129,261 G639S possibly damaging Het
Piwil4 T A 9: 14,736,816 K156* probably null Het
Pkmyt1 T A 17: 23,734,113 H214Q probably damaging Het
Pnpt1 G A 11: 29,154,867 R597Q probably benign Het
Poteg C A 8: 27,473,567 A344E probably benign Het
Rad21l A G 2: 151,667,920 M87T probably benign Het
Ranbp17 T C 11: 33,474,896 I487V probably benign Het
Rap1gap2 C A 11: 74,392,231 R681L probably damaging Het
Rimbp2 C A 5: 128,774,269 R871L probably damaging Het
Rnf135 T C 11: 80,189,225 V114A probably benign Het
Skiv2l T A 17: 34,841,470 H849L probably benign Het
Snai2 A G 16: 14,707,164 H178R possibly damaging Het
Stip1 C T 19: 7,021,810 G467S possibly damaging Het
Tdrd12 G T 7: 35,487,589 D625E Het
Tlr6 A G 5: 64,953,776 V596A probably benign Het
Trak2 T G 1: 58,903,590 N886H probably damaging Het
Tsga10 T A 1: 37,840,614 D32V probably damaging Het
Vmn1r214 A G 13: 23,035,026 D230G probably damaging Het
Vmn2r108 A G 17: 20,462,500 L814S probably damaging Het
Zbbx T C 3: 75,081,737 D353G probably benign Het
Other mutations in Taar1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00782:Taar1 APN 10 23920446 missense probably benign 0.00
R0022:Taar1 UTSW 10 23920727 missense probably benign 0.45
R0126:Taar1 UTSW 10 23920547 missense probably benign 0.00
R0442:Taar1 UTSW 10 23920482 missense possibly damaging 0.80
R0720:Taar1 UTSW 10 23921073 missense probably damaging 1.00
R0931:Taar1 UTSW 10 23921283 missense probably damaging 1.00
R1270:Taar1 UTSW 10 23920533 missense probably damaging 1.00
R1834:Taar1 UTSW 10 23921189 missense probably benign 0.04
R2137:Taar1 UTSW 10 23921270 missense probably benign
R3765:Taar1 UTSW 10 23921307 missense probably damaging 1.00
R3873:Taar1 UTSW 10 23920584 missense probably damaging 1.00
R5334:Taar1 UTSW 10 23920545 missense probably damaging 1.00
R5418:Taar1 UTSW 10 23921316 missense possibly damaging 0.91
R5578:Taar1 UTSW 10 23920820 missense possibly damaging 0.71
R7048:Taar1 UTSW 10 23920824 missense probably benign 0.40
R7163:Taar1 UTSW 10 23921020 missense probably benign 0.38
R7707:Taar1 UTSW 10 23921237 missense possibly damaging 0.69
R7854:Taar1 UTSW 10 23920782 missense probably benign 0.00
R7937:Taar1 UTSW 10 23920782 missense probably benign 0.00
R8036:Taar1 UTSW 10 23921135 missense not run
Predicted Primers PCR Primer
(F):5'- ATATCATGCTGAGCTCCGCC -3'
(R):5'- TGATCCCTAAGGTCTTCGCG -3'

Sequencing Primer
(F):5'- GAGCTCCGCCTCCATTTTC -3'
(R):5'- CCAACTTGAACATTCGTACGATTG -3'
Posted On2019-05-15