Incidental Mutation 'R7096:Pdzrn4'
ID 550514
Institutional Source Beutler Lab
Gene Symbol Pdzrn4
Ensembl Gene ENSMUSG00000036218
Gene Name PDZ domain containing RING finger 4
Synonyms 1110017D07Rik, SAMCAP3L, LNX4
MMRRC Submission 045188-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.214) question?
Stock # R7096 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 92294762-92669700 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 92295384 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 197 (Q197K)
Ref Sequence ENSEMBL: ENSMUSP00000133159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169942]
AlphaFold E9PUZ9
Predicted Effect probably benign
Transcript: ENSMUST00000169942
AA Change: Q197K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000133159
Gene: ENSMUSG00000036218
AA Change: Q197K

DomainStartEndE-ValueType
RING 22 56 1.38e-1 SMART
low complexity region 101 124 N/A INTRINSIC
PDZ 213 295 3.82e-20 SMART
PDZ 393 468 3.01e-18 SMART
low complexity region 479 498 N/A INTRINSIC
low complexity region 506 517 N/A INTRINSIC
coiled coil region 633 669 N/A INTRINSIC
low complexity region 802 816 N/A INTRINSIC
low complexity region 935 948 N/A INTRINSIC
low complexity region 971 980 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (68/70)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd18 T G 3: 40,888,305 (GRCm39) M383R probably damaging Het
Acd T A 8: 106,425,121 (GRCm39) E366V possibly damaging Het
Acvr2b T A 9: 119,257,255 (GRCm39) probably null Het
Alg10b C T 15: 90,111,564 (GRCm39) T136I probably benign Het
Ankrd42 T A 7: 92,241,040 (GRCm39) K440* probably null Het
Apc T A 18: 34,449,010 (GRCm39) S1969T probably damaging Het
Arhgef25 T C 10: 127,019,897 (GRCm39) Y447C probably damaging Het
AW146154 G A 7: 41,130,867 (GRCm39) A83V probably benign Het
Bach1 G A 16: 87,516,179 (GRCm39) R240Q probably benign Het
Barhl1 T G 2: 28,799,726 (GRCm39) I300L probably benign Het
Brd1 C A 15: 88,598,138 (GRCm39) R536L probably damaging Het
Brms1 T A 19: 5,096,708 (GRCm39) I130N probably damaging Het
Ccdc68 A G 18: 70,073,241 (GRCm39) H63R probably damaging Het
Ccl28 A G 13: 120,112,429 (GRCm39) I74V probably benign Het
Cd300ld T A 11: 114,878,321 (GRCm39) I64F possibly damaging Het
Cdkl2 G A 5: 92,181,043 (GRCm39) Q199* probably null Het
Cdkn2c C T 4: 109,518,555 (GRCm39) R133Q probably benign Het
Coq2 A G 5: 100,811,586 (GRCm39) probably benign Het
Coq6 T C 12: 84,408,595 (GRCm39) probably null Het
Csmd2 C T 4: 128,356,519 (GRCm39) S1608L Het
Cyp11b2 T A 15: 74,727,837 (GRCm39) R82W probably damaging Het
Cyp2d10 T C 15: 82,289,462 (GRCm39) T217A probably benign Het
Dclk2 C T 3: 86,700,566 (GRCm39) R638H probably damaging Het
Dnah7a T C 1: 53,522,599 (GRCm39) I2880V possibly damaging Het
Dync1h1 C A 12: 110,623,512 (GRCm39) T3595K probably damaging Het
Ecscr T A 18: 35,848,478 (GRCm39) E183V probably damaging Het
Elovl6 A G 3: 129,398,755 (GRCm39) N52S probably benign Het
Eps8l1 G T 7: 4,477,190 (GRCm39) A455S probably benign Het
Gpat2 A G 2: 127,270,209 (GRCm39) N74S probably benign Het
Gstk1 C A 6: 42,226,407 (GRCm39) T172K probably damaging Het
Gtf3c1 T C 7: 125,295,731 (GRCm39) probably null Het
Gucy2c T C 6: 136,705,339 (GRCm39) D532G probably benign Het
Hoxc12 T A 15: 102,845,473 (GRCm39) N62K possibly damaging Het
Hsdl1 C A 8: 120,293,064 (GRCm39) A124S possibly damaging Het
Il11 T C 7: 4,778,995 (GRCm39) Y45C probably damaging Het
Lcat C T 8: 106,666,309 (GRCm39) M404I possibly damaging Het
Ldhb A G 6: 142,447,099 (GRCm39) F72L probably benign Het
Map10 T C 8: 126,398,662 (GRCm39) L685P probably damaging Het
Me2 A G 18: 73,927,961 (GRCm39) V174A probably benign Het
Med13l C A 5: 118,859,991 (GRCm39) Q328K possibly damaging Het
Mta2 A T 19: 8,925,139 (GRCm39) I336F probably damaging Het
Mterf1a A T 5: 3,941,769 (GRCm39) I33N probably damaging Het
Myo15b T A 11: 115,782,324 (GRCm39) probably null Het
Myof C A 19: 37,924,648 (GRCm39) G1215V probably damaging Het
Nlgn2 G A 11: 69,716,516 (GRCm39) T675M probably damaging Het
Or1e26 T A 11: 73,480,463 (GRCm39) M34L probably benign Het
Or5p61 C A 7: 107,758,848 (GRCm39) M77I probably benign Het
Or6c38 T C 10: 128,929,715 (GRCm39) I43V probably damaging Het
Padi3 T C 4: 140,527,435 (GRCm39) D122G probably damaging Het
Pcnx3 G A 19: 5,722,643 (GRCm39) R1350C probably damaging Het
Pitpnm2 C T 5: 124,267,324 (GRCm39) G639S possibly damaging Het
Piwil4 T A 9: 14,648,112 (GRCm39) K156* probably null Het
Pkmyt1 T A 17: 23,953,087 (GRCm39) H214Q probably damaging Het
Pnpt1 G A 11: 29,104,867 (GRCm39) R597Q probably benign Het
Poteg C A 8: 27,963,595 (GRCm39) A344E probably benign Het
Rad21l A G 2: 151,509,840 (GRCm39) M87T probably benign Het
Ranbp17 T C 11: 33,424,896 (GRCm39) I487V probably benign Het
Rap1gap2 C A 11: 74,283,057 (GRCm39) R681L probably damaging Het
Rimbp2 C A 5: 128,851,333 (GRCm39) R871L probably damaging Het
Rnf135 T C 11: 80,080,051 (GRCm39) V114A probably benign Het
Skic2 T A 17: 35,060,446 (GRCm39) H849L probably benign Het
Snai2 A G 16: 14,525,028 (GRCm39) H178R possibly damaging Het
Stip1 C T 19: 6,999,178 (GRCm39) G467S possibly damaging Het
Taar1 A T 10: 23,796,809 (GRCm39) E169V possibly damaging Het
Tdrd12 G T 7: 35,187,014 (GRCm39) D625E Het
Tlr6 A G 5: 65,111,119 (GRCm39) V596A probably benign Het
Trak2 T G 1: 58,942,749 (GRCm39) N886H probably damaging Het
Tsga10 T A 1: 37,879,695 (GRCm39) D32V probably damaging Het
Vmn1r214 A G 13: 23,219,196 (GRCm39) D230G probably damaging Het
Vmn2r108 A G 17: 20,682,762 (GRCm39) L814S probably damaging Het
Zbbx T C 3: 74,989,044 (GRCm39) D353G probably benign Het
Other mutations in Pdzrn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01932:Pdzrn4 APN 15 92,644,159 (GRCm39) missense probably damaging 1.00
IGL01991:Pdzrn4 APN 15 92,299,807 (GRCm39) splice site probably null
IGL02103:Pdzrn4 APN 15 92,667,768 (GRCm39) missense probably damaging 1.00
IGL02243:Pdzrn4 APN 15 92,668,577 (GRCm39) missense probably benign 0.30
IGL02269:Pdzrn4 APN 15 92,667,731 (GRCm39) missense probably damaging 1.00
IGL03005:Pdzrn4 APN 15 92,668,272 (GRCm39) missense probably damaging 1.00
PIT4362001:Pdzrn4 UTSW 15 92,667,762 (GRCm39) missense possibly damaging 0.46
R0243:Pdzrn4 UTSW 15 92,668,200 (GRCm39) missense possibly damaging 0.46
R0367:Pdzrn4 UTSW 15 92,655,538 (GRCm39) missense possibly damaging 0.53
R0972:Pdzrn4 UTSW 15 92,655,592 (GRCm39) missense probably benign 0.00
R1168:Pdzrn4 UTSW 15 92,668,152 (GRCm39) missense probably benign 0.16
R1411:Pdzrn4 UTSW 15 92,668,894 (GRCm39) makesense probably null
R1466:Pdzrn4 UTSW 15 92,668,418 (GRCm39) missense probably benign 0.00
R1466:Pdzrn4 UTSW 15 92,668,418 (GRCm39) missense probably benign 0.00
R1489:Pdzrn4 UTSW 15 92,575,593 (GRCm39) missense probably benign
R1503:Pdzrn4 UTSW 15 92,297,685 (GRCm39) missense probably damaging 0.99
R1561:Pdzrn4 UTSW 15 92,575,518 (GRCm39) missense possibly damaging 0.84
R1584:Pdzrn4 UTSW 15 92,668,418 (GRCm39) missense probably benign 0.00
R1733:Pdzrn4 UTSW 15 92,299,855 (GRCm39) missense probably benign 0.06
R1965:Pdzrn4 UTSW 15 92,644,190 (GRCm39) splice site probably null
R2061:Pdzrn4 UTSW 15 92,668,041 (GRCm39) missense probably damaging 0.99
R3010:Pdzrn4 UTSW 15 92,667,692 (GRCm39) missense probably benign 0.32
R4016:Pdzrn4 UTSW 15 92,297,630 (GRCm39) missense probably benign
R4032:Pdzrn4 UTSW 15 92,667,414 (GRCm39) missense probably damaging 1.00
R4110:Pdzrn4 UTSW 15 92,668,745 (GRCm39) missense probably benign 0.26
R4180:Pdzrn4 UTSW 15 92,299,898 (GRCm39) missense possibly damaging 0.93
R4539:Pdzrn4 UTSW 15 92,668,470 (GRCm39) missense probably damaging 1.00
R4617:Pdzrn4 UTSW 15 92,667,723 (GRCm39) missense probably damaging 1.00
R4734:Pdzrn4 UTSW 15 92,668,133 (GRCm39) nonsense probably null
R4900:Pdzrn4 UTSW 15 92,668,638 (GRCm39) missense probably damaging 1.00
R5422:Pdzrn4 UTSW 15 92,575,502 (GRCm39) missense probably benign 0.01
R5444:Pdzrn4 UTSW 15 92,668,806 (GRCm39) missense probably damaging 1.00
R5772:Pdzrn4 UTSW 15 92,655,562 (GRCm39) missense probably damaging 1.00
R5775:Pdzrn4 UTSW 15 92,655,562 (GRCm39) missense probably damaging 1.00
R5935:Pdzrn4 UTSW 15 92,295,255 (GRCm39) missense probably benign 0.01
R6192:Pdzrn4 UTSW 15 92,655,562 (GRCm39) missense probably damaging 1.00
R6210:Pdzrn4 UTSW 15 92,655,562 (GRCm39) missense probably damaging 1.00
R6258:Pdzrn4 UTSW 15 92,655,562 (GRCm39) missense probably damaging 1.00
R6259:Pdzrn4 UTSW 15 92,655,562 (GRCm39) missense probably damaging 1.00
R6391:Pdzrn4 UTSW 15 92,578,418 (GRCm39) missense probably damaging 0.99
R6613:Pdzrn4 UTSW 15 92,575,455 (GRCm39) missense probably damaging 0.99
R7046:Pdzrn4 UTSW 15 92,668,303 (GRCm39) nonsense probably null
R7451:Pdzrn4 UTSW 15 92,667,948 (GRCm39) missense possibly damaging 0.68
R8075:Pdzrn4 UTSW 15 92,575,605 (GRCm39) missense probably damaging 0.99
R8125:Pdzrn4 UTSW 15 92,641,476 (GRCm39) missense probably damaging 1.00
R8324:Pdzrn4 UTSW 15 92,668,818 (GRCm39) missense probably damaging 1.00
R9332:Pdzrn4 UTSW 15 92,295,216 (GRCm39) missense probably benign
R9555:Pdzrn4 UTSW 15 92,297,703 (GRCm39) missense probably damaging 1.00
R9558:Pdzrn4 UTSW 15 92,299,877 (GRCm39) missense possibly damaging 0.46
R9622:Pdzrn4 UTSW 15 92,294,949 (GRCm39) missense probably benign
R9763:Pdzrn4 UTSW 15 92,668,376 (GRCm39) missense probably damaging 1.00
R9796:Pdzrn4 UTSW 15 92,578,353 (GRCm39) missense possibly damaging 0.93
X0018:Pdzrn4 UTSW 15 92,295,104 (GRCm39) missense probably benign 0.01
X0020:Pdzrn4 UTSW 15 92,295,104 (GRCm39) missense probably benign 0.01
X0021:Pdzrn4 UTSW 15 92,575,590 (GRCm39) missense probably damaging 1.00
X0026:Pdzrn4 UTSW 15 92,295,104 (GRCm39) missense probably benign 0.01
X0027:Pdzrn4 UTSW 15 92,578,393 (GRCm39) missense possibly damaging 0.92
X0027:Pdzrn4 UTSW 15 92,295,104 (GRCm39) missense probably benign 0.01
X0065:Pdzrn4 UTSW 15 92,295,104 (GRCm39) missense probably benign 0.01
Z1176:Pdzrn4 UTSW 15 92,294,838 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGTGCAACTACAGCGGACAG -3'
(R):5'- CCTAAACGGTGTTTCTGGGG -3'

Sequencing Primer
(F):5'- ACCAAGACCTGCTGGAGTG -3'
(R):5'- TTCTGGGGCAGCGATGCAG -3'
Posted On 2019-05-15