Mutagenetix > Incidental Mutation

Incidental Mutation 'R7096:Pdzrn4'

550514

Institutional Source

Beutler Lab

Gene Symbol

Pdzrn4

Ensembl Gene

ENSMUSG00000036218

Gene Name

PDZ domain containing RING finger 4

Synonyms

1110017D07Rik, LNX4, SAMCAP3L

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.240) question?

Stock #

R7096 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

92396881-92771819 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 92397503 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Lysine at position 197 (Q197K)

Ref Sequence

ENSEMBL: ENSMUSP00000133159 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169942]

AlphaFold

E9PUZ9

Predicted Effect

probably benign
Transcript: ENSMUST00000169942
AA Change: Q197K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000133159
Gene: ENSMUSG00000036218
AA Change: Q197K

Domain	Start	End	E-Value	Type
RING	22	56	1.38e-1	SMART
low complexity region	101	124	N/A	INTRINSIC
PDZ	213	295	3.82e-20	SMART
PDZ	393	468	3.01e-18	SMART
low complexity region	479	498	N/A	INTRINSIC
low complexity region	506	517	N/A	INTRINSIC
coiled coil region	633	669	N/A	INTRINSIC
low complexity region	802	816	N/A	INTRINSIC
low complexity region	935	948	N/A	INTRINSIC
low complexity region	971	980	N/A	INTRINSIC

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

97% (68/70)

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd18	T	G	3: 40,933,870	M383R	probably damaging	Het
Acd	T	A	8: 105,698,489	E366V	possibly damaging	Het
Acvr2b	T	A	9: 119,428,189		probably null	Het
Alg10b	C	T	15: 90,227,361	T136I	probably benign	Het
Ankrd42	T	A	7: 92,591,832	K440*	probably null	Het
Apc	T	A	18: 34,315,957	S1969T	probably damaging	Het
Arhgef25	T	C	10: 127,184,028	Y447C	probably damaging	Het
AW146154	G	A	7: 41,481,443	A83V	probably benign	Het
Bach1	G	A	16: 87,719,291	R240Q	probably benign	Het
Barhl1	T	G	2: 28,909,714	I300L	probably benign	Het
Brd1	C	A	15: 88,713,935	R536L	probably damaging	Het
Brms1	T	A	19: 5,046,680	I130N	probably damaging	Het
Ccdc68	A	G	18: 69,940,170	H63R	probably damaging	Het
Ccl28	A	G	13: 119,650,893	I74V	probably benign	Het
Cd300ld	T	A	11: 114,987,495	I64F	possibly damaging	Het
Cdkl2	G	A	5: 92,033,184	Q199*	probably null	Het
Cdkn2c	C	T	4: 109,661,358	R133Q	probably benign	Het
Coq2	A	G	5: 100,663,720		probably benign	Het
Coq6	T	C	12: 84,361,821		probably null	Het
Csmd2	C	T	4: 128,462,726	S1608L		Het
Cyp11b2	T	A	15: 74,855,988	R82W	probably damaging	Het
Cyp2d10	T	C	15: 82,405,261	T217A	probably benign	Het
Dclk2	C	T	3: 86,793,259	R638H	probably damaging	Het
Dnah7a	T	C	1: 53,483,440	I2880V	possibly damaging	Het
Dync1h1	C	A	12: 110,657,078	T3595K	probably damaging	Het
Ecscr	T	A	18: 35,715,425	E183V	probably damaging	Het
Elovl6	A	G	3: 129,605,106	N52S	probably benign	Het
Eps8l1	G	T	7: 4,474,191	A455S	probably benign	Het
Gpat2	A	G	2: 127,428,289	N74S	probably benign	Het
Gstk1	C	A	6: 42,249,473	T172K	probably damaging	Het
Gtf3c1	T	C	7: 125,696,559		probably null	Het
Gucy2c	T	C	6: 136,728,341	D532G	probably benign	Het
Hoxc12	T	A	15: 102,937,038	N62K	possibly damaging	Het
Hsdl1	C	A	8: 119,566,325	A124S	possibly damaging	Het
Il11	T	C	7: 4,775,996	Y45C	probably damaging	Het
Lcat	C	T	8: 105,939,677	M404I	possibly damaging	Het
Ldhb	A	G	6: 142,501,373	F72L	probably benign	Het
Map10	T	C	8: 125,671,923	L685P	probably damaging	Het
Me2	A	G	18: 73,794,890	V174A	probably benign	Het
Med13l	C	A	5: 118,721,926	Q328K	possibly damaging	Het
Mta2	A	T	19: 8,947,775	I336F	probably damaging	Het
Mterf1a	A	T	5: 3,891,769	I33N	probably damaging	Het
Myo15b	T	A	11: 115,891,498		probably null	Het
Myof	C	A	19: 37,936,200	G1215V	probably damaging	Het
Nlgn2	G	A	11: 69,825,690	T675M	probably damaging	Het
Olfr385	T	A	11: 73,589,637	M34L	probably benign	Het
Olfr485	C	A	7: 108,159,641	M77I	probably benign	Het
Olfr768	T	C	10: 129,093,846	I43V	probably damaging	Het
Padi3	T	C	4: 140,800,124	D122G	probably damaging	Het
Pcnx3	G	A	19: 5,672,615	R1350C	probably damaging	Het
Pitpnm2	C	T	5: 124,129,261	G639S	possibly damaging	Het
Piwil4	T	A	9: 14,736,816	K156*	probably null	Het
Pkmyt1	T	A	17: 23,734,113	H214Q	probably damaging	Het
Pnpt1	G	A	11: 29,154,867	R597Q	probably benign	Het
Poteg	C	A	8: 27,473,567	A344E	probably benign	Het
Rad21l	A	G	2: 151,667,920	M87T	probably benign	Het
Ranbp17	T	C	11: 33,474,896	I487V	probably benign	Het
Rap1gap2	C	A	11: 74,392,231	R681L	probably damaging	Het
Rimbp2	C	A	5: 128,774,269	R871L	probably damaging	Het
Rnf135	T	C	11: 80,189,225	V114A	probably benign	Het
Skiv2l	T	A	17: 34,841,470	H849L	probably benign	Het
Snai2	A	G	16: 14,707,164	H178R	possibly damaging	Het
Stip1	C	T	19: 7,021,810	G467S	possibly damaging	Het
Taar1	A	T	10: 23,920,911	E169V	possibly damaging	Het
Tdrd12	G	T	7: 35,487,589	D625E		Het
Tlr6	A	G	5: 64,953,776	V596A	probably benign	Het
Trak2	T	G	1: 58,903,590	N886H	probably damaging	Het
Tsga10	T	A	1: 37,840,614	D32V	probably damaging	Het
Vmn1r214	A	G	13: 23,035,026	D230G	probably damaging	Het
Vmn2r108	A	G	17: 20,462,500	L814S	probably damaging	Het
Zbbx	T	C	3: 75,081,737	D353G	probably benign	Het

Other mutations in Pdzrn4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01932:Pdzrn4	APN	15	92746278	missense	probably damaging	1.00
IGL01991:Pdzrn4	APN	15	92401926	splice site	probably null
IGL02103:Pdzrn4	APN	15	92769887	missense	probably damaging	1.00
IGL02243:Pdzrn4	APN	15	92770696	missense	probably benign	0.30
IGL02269:Pdzrn4	APN	15	92769850	missense	probably damaging	1.00
IGL03005:Pdzrn4	APN	15	92770391	missense	probably damaging	1.00
PIT4362001:Pdzrn4	UTSW	15	92769881	missense	possibly damaging	0.46
R0243:Pdzrn4	UTSW	15	92770319	missense	possibly damaging	0.46
R0367:Pdzrn4	UTSW	15	92757657	missense	possibly damaging	0.53
R0972:Pdzrn4	UTSW	15	92757711	missense	probably benign	0.00
R1168:Pdzrn4	UTSW	15	92770271	missense	probably benign	0.16
R1411:Pdzrn4	UTSW	15	92771013	makesense	probably null
R1466:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1466:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1489:Pdzrn4	UTSW	15	92677712	missense	probably benign
R1503:Pdzrn4	UTSW	15	92399804	missense	probably damaging	0.99
R1561:Pdzrn4	UTSW	15	92677637	missense	possibly damaging	0.84
R1584:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1733:Pdzrn4	UTSW	15	92401974	missense	probably benign	0.06
R1965:Pdzrn4	UTSW	15	92746309	splice site	probably null
R2061:Pdzrn4	UTSW	15	92770160	missense	probably damaging	0.99
R3010:Pdzrn4	UTSW	15	92769811	missense	probably benign	0.32
R4016:Pdzrn4	UTSW	15	92399749	missense	probably benign
R4032:Pdzrn4	UTSW	15	92769533	missense	probably damaging	1.00
R4110:Pdzrn4	UTSW	15	92770864	missense	probably benign	0.26
R4180:Pdzrn4	UTSW	15	92402017	missense	possibly damaging	0.93
R4539:Pdzrn4	UTSW	15	92770589	missense	probably damaging	1.00
R4617:Pdzrn4	UTSW	15	92769842	missense	probably damaging	1.00
R4734:Pdzrn4	UTSW	15	92770252	nonsense	probably null
R4900:Pdzrn4	UTSW	15	92770757	missense	probably damaging	1.00
R5422:Pdzrn4	UTSW	15	92677621	missense	probably benign	0.01
R5444:Pdzrn4	UTSW	15	92770925	missense	probably damaging	1.00
R5772:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R5775:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R5935:Pdzrn4	UTSW	15	92397374	missense	probably benign	0.01
R6192:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6210:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6258:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6259:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6391:Pdzrn4	UTSW	15	92680537	missense	probably damaging	0.99
R6613:Pdzrn4	UTSW	15	92677574	missense	probably damaging	0.99
R7046:Pdzrn4	UTSW	15	92770422	nonsense	probably null
R7451:Pdzrn4	UTSW	15	92770067	missense	possibly damaging	0.68
R8075:Pdzrn4	UTSW	15	92677724	missense	probably damaging	0.99
R8125:Pdzrn4	UTSW	15	92743595	missense	probably damaging	1.00
R8324:Pdzrn4	UTSW	15	92770937	missense	probably damaging	1.00
R9332:Pdzrn4	UTSW	15	92397335	missense	probably benign
R9555:Pdzrn4	UTSW	15	92399822	missense	probably damaging	1.00
R9558:Pdzrn4	UTSW	15	92401996	missense	possibly damaging	0.46
R9622:Pdzrn4	UTSW	15	92397068	missense	probably benign
R9763:Pdzrn4	UTSW	15	92770495	missense	probably damaging	1.00
R9796:Pdzrn4	UTSW	15	92680472	missense	possibly damaging	0.93
X0018:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0020:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0021:Pdzrn4	UTSW	15	92677709	missense	probably damaging	1.00
X0026:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0027:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0027:Pdzrn4	UTSW	15	92680512	missense	possibly damaging	0.92
X0065:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
Z1176:Pdzrn4	UTSW	15	92396957	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- AGTGCAACTACAGCGGACAG -3'
(R):5'- CCTAAACGGTGTTTCTGGGG -3'

Sequencing Primer
(F):5'- ACCAAGACCTGCTGGAGTG -3'
(R):5'- TTCTGGGGCAGCGATGCAG -3'

Posted On

2019-05-15