Incidental Mutation 'R7096:Stip1'
ID550527
Institutional Source Beutler Lab
Gene Symbol Stip1
Ensembl Gene ENSMUSG00000024966
Gene Namestress-induced phosphoprotein 1
SynonymsHop, IEF SSP 3521, Hsp70/Hsp90 organizing protein, STI1, p60
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7096 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location7020696-7040026 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 7021810 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 467 (G467S)
Ref Sequence ENSEMBL: ENSMUSP00000025918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025918] [ENSMUST00000040772]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025918
AA Change: G467S

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000025918
Gene: ENSMUSG00000024966
AA Change: G467S

DomainStartEndE-ValueType
TPR 4 37 3.07e-5 SMART
TPR 38 71 1.63e0 SMART
TPR 72 105 5.87e-2 SMART
STI1 130 169 4.84e-1 SMART
low complexity region 192 220 N/A INTRINSIC
TPR 225 258 7.45e-4 SMART
TPR 259 292 1.1e-1 SMART
TPR 300 333 1.09e-5 SMART
TPR 360 393 1.07e-4 SMART
TPR 394 427 9.45e-6 SMART
TPR 428 461 3.29e-5 SMART
STI1 492 531 1.66e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000040772
SMART Domains Protein: ENSMUSP00000037858
Gene: ENSMUSG00000024965

DomainStartEndE-ValueType
Blast:B41 14 77 6e-32 BLAST
B41 94 556 1.66e-28 SMART
PH 350 455 2.26e-12 SMART
Meta Mutation Damage Score 0.5146 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] STIP1 is an adaptor protein that coordinates the functions of HSP70 (see HSPA1A; MIM 140550) and HSP90 (see HSP90AA1; MIM 140571) in protein folding. It is thought to assist in the transfer of proteins from HSP70 to HSP90 by binding both HSP90 and substrate-bound HSP70. STIP1 also stimulates the ATPase activity of HSP70 and inhibits the ATPase activity of HSP90, suggesting that it regulates both the conformations and ATPase cycles of these chaperones (Song and Masison, 2005 [PubMed 16100115]).[supplied by OMIM, Jul 2009]
PHENOTYPE: Mice homozygous for a targeted allele exhibit embryonic lethality by E10.5, actute inflammation in the placental labyrinth, poorly formed neural tube and limb buds and increase double-strand breaks. Mice heterozygous for this allele exhibit susceptibility to ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd18 T G 3: 40,933,870 M383R probably damaging Het
Acd T A 8: 105,698,489 E366V possibly damaging Het
Acvr2b T A 9: 119,428,189 probably null Het
Alg10b C T 15: 90,227,361 T136I probably benign Het
Ankrd42 T A 7: 92,591,832 K440* probably null Het
Apc T A 18: 34,315,957 S1969T probably damaging Het
Arhgef25 T C 10: 127,184,028 Y447C probably damaging Het
AW146154 G A 7: 41,481,443 A83V probably benign Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Barhl1 T G 2: 28,909,714 I300L probably benign Het
Brd1 C A 15: 88,713,935 R536L probably damaging Het
Brms1 T A 19: 5,046,680 I130N probably damaging Het
Ccdc68 A G 18: 69,940,170 H63R probably damaging Het
Ccl28 A G 13: 119,650,893 I74V probably benign Het
Cd300ld T A 11: 114,987,495 I64F possibly damaging Het
Cdkl2 G A 5: 92,033,184 Q199* probably null Het
Cdkn2c C T 4: 109,661,358 R133Q probably benign Het
Coq2 A G 5: 100,663,720 probably benign Het
Coq6 T C 12: 84,361,821 probably null Het
Csmd2 C T 4: 128,462,726 S1608L Het
Cyp11b2 T A 15: 74,855,988 R82W probably damaging Het
Cyp2d10 T C 15: 82,405,261 T217A probably benign Het
Dclk2 C T 3: 86,793,259 R638H probably damaging Het
Dnah7a T C 1: 53,483,440 I2880V possibly damaging Het
Dync1h1 C A 12: 110,657,078 T3595K probably damaging Het
Ecscr T A 18: 35,715,425 E183V probably damaging Het
Elovl6 A G 3: 129,605,106 N52S probably benign Het
Eps8l1 G T 7: 4,474,191 A455S probably benign Het
Gpat2 A G 2: 127,428,289 N74S probably benign Het
Gstk1 C A 6: 42,249,473 T172K probably damaging Het
Gtf3c1 T C 7: 125,696,559 probably null Het
Gucy2c T C 6: 136,728,341 D532G probably benign Het
Hoxc12 T A 15: 102,937,038 N62K possibly damaging Het
Hsdl1 C A 8: 119,566,325 A124S possibly damaging Het
Il11 T C 7: 4,775,996 Y45C probably damaging Het
Lcat C T 8: 105,939,677 M404I possibly damaging Het
Ldhb A G 6: 142,501,373 F72L probably benign Het
Map10 T C 8: 125,671,923 L685P probably damaging Het
Me2 A G 18: 73,794,890 V174A probably benign Het
Med13l C A 5: 118,721,926 Q328K possibly damaging Het
Mta2 A T 19: 8,947,775 I336F probably damaging Het
Mterf1a A T 5: 3,891,769 I33N probably damaging Het
Myo15b T A 11: 115,891,498 probably null Het
Myof C A 19: 37,936,200 G1215V probably damaging Het
Nlgn2 G A 11: 69,825,690 T675M probably damaging Het
Olfr385 T A 11: 73,589,637 M34L probably benign Het
Olfr485 C A 7: 108,159,641 M77I probably benign Het
Olfr768 T C 10: 129,093,846 I43V probably damaging Het
Padi3 T C 4: 140,800,124 D122G probably damaging Het
Pcnx3 G A 19: 5,672,615 R1350C probably damaging Het
Pdzrn4 C A 15: 92,397,503 Q197K probably benign Het
Pitpnm2 C T 5: 124,129,261 G639S possibly damaging Het
Piwil4 T A 9: 14,736,816 K156* probably null Het
Pkmyt1 T A 17: 23,734,113 H214Q probably damaging Het
Pnpt1 G A 11: 29,154,867 R597Q probably benign Het
Poteg C A 8: 27,473,567 A344E probably benign Het
Rad21l A G 2: 151,667,920 M87T probably benign Het
Ranbp17 T C 11: 33,474,896 I487V probably benign Het
Rap1gap2 C A 11: 74,392,231 R681L probably damaging Het
Rimbp2 C A 5: 128,774,269 R871L probably damaging Het
Rnf135 T C 11: 80,189,225 V114A probably benign Het
Skiv2l T A 17: 34,841,470 H849L probably benign Het
Snai2 A G 16: 14,707,164 H178R possibly damaging Het
Taar1 A T 10: 23,920,911 E169V possibly damaging Het
Tdrd12 G T 7: 35,487,589 D625E Het
Tlr6 A G 5: 64,953,776 V596A probably benign Het
Trak2 T G 1: 58,903,590 N886H probably damaging Het
Tsga10 T A 1: 37,840,614 D32V probably damaging Het
Vmn1r214 A G 13: 23,035,026 D230G probably damaging Het
Vmn2r108 A G 17: 20,462,500 L814S probably damaging Het
Zbbx T C 3: 75,081,737 D353G probably benign Het
Other mutations in Stip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Stip1 APN 19 7021096 unclassified probably benign
IGL02506:Stip1 APN 19 7035489 splice site probably benign
IGL02515:Stip1 APN 19 7022119 missense probably benign 0.23
IGL03009:Stip1 APN 19 7021121 missense probably damaging 1.00
Whisp UTSW 19 7021810 missense possibly damaging 0.92
R1768:Stip1 UTSW 19 7021797 missense probably damaging 1.00
R3081:Stip1 UTSW 19 7035648 missense probably benign 0.42
R4530:Stip1 UTSW 19 7035658 missense probably benign 0.04
R4965:Stip1 UTSW 19 7035570 missense probably benign 0.41
R5638:Stip1 UTSW 19 7032515 missense probably damaging 1.00
R5776:Stip1 UTSW 19 7022025 critical splice donor site probably null
R5840:Stip1 UTSW 19 7022068 missense possibly damaging 0.86
R7064:Stip1 UTSW 19 7035557 missense probably benign 0.18
R7109:Stip1 UTSW 19 7021810 missense possibly damaging 0.92
R7111:Stip1 UTSW 19 7021810 missense possibly damaging 0.92
R7116:Stip1 UTSW 19 7021810 missense possibly damaging 0.92
R7117:Stip1 UTSW 19 7021810 missense possibly damaging 0.92
R7127:Stip1 UTSW 19 7021810 missense possibly damaging 0.92
R7129:Stip1 UTSW 19 7021810 missense possibly damaging 0.92
R7130:Stip1 UTSW 19 7021810 missense possibly damaging 0.92
R7132:Stip1 UTSW 19 7021810 missense possibly damaging 0.92
R7776:Stip1 UTSW 19 7021773 missense probably benign 0.06
Z1176:Stip1 UTSW 19 7022308 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCAGGCACATAACCTC -3'
(R):5'- AAGGTAAGCTGCTGTTGGCC -3'

Sequencing Primer
(F):5'- GAATGATAGAATTCCCTCTCACTTC -3'
(R):5'- AAGCTGCTGTTGGCCTATAAC -3'
Posted On2019-05-15