Incidental Mutation 'R7097:Olfr340'
ID550538
Institutional Source Beutler Lab
Gene Symbol Olfr340
Ensembl Gene ENSMUSG00000094266
Gene Nameolfactory receptor 340
SynonymsGA_x6K02T2NLDC-33147742-33148680, MOR136-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R7097 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location36452587-36453525 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36452690 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 35 (Y35C)
Ref Sequence ENSEMBL: ENSMUSP00000072632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072854]
Predicted Effect probably damaging
Transcript: ENSMUST00000072854
AA Change: Y35C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072632
Gene: ENSMUSG00000094266
AA Change: Y35C

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.2e-56 PFAM
Pfam:7TM_GPCR_Srsx 35 305 5.8e-6 PFAM
Pfam:7tm_1 41 290 1.4e-23 PFAM
Meta Mutation Damage Score 0.1144 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik A G 17: 9,005,220 N435S probably damaging Het
Aip A T 19: 4,115,381 V195E probably benign Het
Amer3 A T 1: 34,588,788 I703F probably benign Het
Amfr T C 8: 94,012,009 E7G probably benign Het
Angel1 A G 12: 86,726,384 S4P probably damaging Het
Atp2c1 A G 9: 105,464,651 I146T probably damaging Het
Atp6v0e A G 17: 26,695,416 T72A probably benign Het
Bahcc1 T C 11: 120,272,646 V590A possibly damaging Het
Bcl6 A G 16: 23,972,614 V330A possibly damaging Het
Bcl6 T C 16: 23,972,902 D234G probably damaging Het
Btaf1 C T 19: 36,949,102 T58I probably damaging Het
Ccdc175 A T 12: 72,128,409 probably null Het
Cdca4 C A 12: 112,821,569 V180L probably benign Het
Ces1g C A 8: 93,317,037 G425C possibly damaging Het
Chl1 T C 6: 103,706,448 L745P probably damaging Het
Clec4g T A 8: 3,719,518 T42S possibly damaging Het
Ctsg A C 14: 56,100,032 I238S probably damaging Het
Cyb5rl A T 4: 107,087,316 E41V unknown Het
Dcdc2a A G 13: 25,107,698 E222G probably benign Het
Dnaaf1 G T 8: 119,596,799 G509V possibly damaging Het
Dnah5 A G 15: 28,453,264 I4394V probably benign Het
Dot1l T G 10: 80,790,726 S1260R probably damaging Het
Dst T G 1: 34,169,260 I1089S probably damaging Het
Eps8l3 A G 3: 107,884,485 probably null Het
Fam135b A G 15: 71,622,068 V4A possibly damaging Het
Fnip2 T C 3: 79,481,006 E806G probably benign Het
Fryl T A 5: 73,073,908 I1609F probably benign Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gm11639 A T 11: 105,008,961 I4350F possibly damaging Het
Gsn A T 2: 35,295,049 K339* probably null Het
Hecw2 T A 1: 53,865,124 Y1155F possibly damaging Het
Kif20b T A 19: 34,974,492 N1723K probably damaging Het
Kif2b T C 11: 91,576,824 D211G probably benign Het
Lhfpl4 C T 6: 113,176,671 V140I probably benign Het
Med16 C T 10: 79,903,343 G203D probably damaging Het
Mrgpra3 T A 7: 47,589,641 Y179F probably benign Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Myo18b A G 5: 112,874,405 S374P unknown Het
Myoz1 A G 14: 20,649,409 I287T possibly damaging Het
Ncoa6 T C 2: 155,438,063 D11G probably benign Het
Nlrp9c A G 7: 26,385,621 Y178H probably damaging Het
Nmur1 T C 1: 86,387,508 T212A probably damaging Het
Oacyl A G 18: 65,720,252 D143G probably benign Het
Obox5 A G 7: 15,758,807 Y229C probably damaging Het
Olfr347 G T 2: 36,734,424 M34I probably benign Het
Olfr54 C A 11: 51,027,601 L200I probably benign Het
Olfr891 A T 9: 38,180,336 C162* probably null Het
Olfr934 A T 9: 38,982,618 M142K probably benign Het
Pcdhb17 A C 18: 37,486,513 N452T probably benign Het
Pear1 T G 3: 87,751,445 H901P probably benign Het
Pi16 A G 17: 29,326,339 Y192C probably damaging Het
Pip5k1b T G 19: 24,358,060 E362D probably damaging Het
Pla2g5 T C 4: 138,804,519 D58G probably damaging Het
Pole T A 5: 110,325,102 probably null Het
Prdm16 G T 4: 154,345,468 T348K probably damaging Het
Prkdc T A 16: 15,689,343 F896I probably damaging Het
Prmt7 T C 8: 106,235,100 F215S unknown Het
Prss23 T A 7: 89,510,184 T226S probably damaging Het
Ptpn14 G A 1: 189,863,398 W739* probably null Het
Rfx5 G T 3: 94,956,539 G135C probably damaging Het
Scmh1 A G 4: 120,525,055 H573R probably benign Het
Serpina5 G T 12: 104,102,295 probably null Het
Sh3rf2 G A 18: 42,104,162 probably null Het
Slc38a2 T C 15: 96,693,301 M229V probably damaging Het
Slc6a17 C G 3: 107,493,148 G222R probably damaging Het
Sp110 C T 1: 85,579,685 G367D possibly damaging Het
Srcap C A 7: 127,539,041 L1128M probably damaging Het
Tmem189 C G 2: 167,661,478 A7P probably benign Het
Tpra1 T A 6: 88,908,294 I76N probably damaging Het
Trav6-4 A T 14: 53,454,592 Y52F probably benign Het
Trp63 C A 16: 25,820,477 H138Q probably damaging Het
Trub2 A G 2: 29,779,826 V177A possibly damaging Het
Ugt2a2 T C 5: 87,460,396 D528G possibly damaging Het
Wnk2 C A 13: 49,102,838 R269L possibly damaging Het
Zc3h12c T A 9: 52,115,926 Q731L possibly damaging Het
Other mutations in Olfr340
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01467:Olfr340 APN 2 36452644 nonsense probably null
IGL01590:Olfr340 APN 2 36452992 missense probably benign 0.39
IGL01614:Olfr340 APN 2 36452624 missense probably benign 0.32
IGL02470:Olfr340 APN 2 36452597 missense probably benign 0.00
IGL02943:Olfr340 APN 2 36453039 missense probably benign 0.05
R0089:Olfr340 UTSW 2 36453095 missense probably benign 0.00
R0600:Olfr340 UTSW 2 36452648 missense probably benign 0.06
R0881:Olfr340 UTSW 2 36453440 missense probably damaging 1.00
R1945:Olfr340 UTSW 2 36453031 missense probably damaging 1.00
R2184:Olfr340 UTSW 2 36453034 missense probably benign
R2196:Olfr340 UTSW 2 36452588 start codon destroyed probably null 1.00
R2419:Olfr340 UTSW 2 36453326 missense probably damaging 1.00
R2859:Olfr340 UTSW 2 36453130 missense probably benign 0.01
R2964:Olfr340 UTSW 2 36452767 missense probably damaging 1.00
R4677:Olfr340 UTSW 2 36453050 missense probably benign 0.00
R4867:Olfr340 UTSW 2 36453199 missense probably benign
R5468:Olfr340 UTSW 2 36453443 missense probably damaging 0.99
R5582:Olfr340 UTSW 2 36453221 missense probably benign 0.03
R6335:Olfr340 UTSW 2 36452722 missense probably benign 0.22
R6415:Olfr340 UTSW 2 36452605 missense probably damaging 0.99
R6664:Olfr340 UTSW 2 36453098 missense probably benign 0.00
R6873:Olfr340 UTSW 2 36453496 missense probably benign 0.00
R7122:Olfr340 UTSW 2 36452690 missense probably damaging 1.00
R7199:Olfr340 UTSW 2 36452860 missense probably damaging 1.00
R7275:Olfr340 UTSW 2 36452839 missense probably benign 0.05
R7812:Olfr340 UTSW 2 36453278 missense probably benign 0.00
Z1088:Olfr340 UTSW 2 36452906 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TGATCTACAACTGGGTCTCATCTG -3'
(R):5'- CACCCAGCATATGAGATGGATTG -3'

Sequencing Primer
(F):5'- ACTGGGTCTCATCTGATAATAGTTC -3'
(R):5'- CCAGCATATGAGATGGATTGACTGTG -3'
Posted On2019-05-15