Incidental Mutation 'R7097:Cyb5rl'
ID550546
Institutional Source Beutler Lab
Gene Symbol Cyb5rl
Ensembl Gene ENSMUSG00000028621
Gene Namecytochrome b5 reductase-like
Synonyms2810410C14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R7097 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location107066988-107088268 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 107087316 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 41 (E41V)
Ref Sequence ENSEMBL: ENSMUSP00000123206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030364] [ENSMUST00000106756] [ENSMUST00000106758] [ENSMUST00000106760] [ENSMUST00000127916] [ENSMUST00000137269] [ENSMUST00000149453]
Predicted Effect probably benign
Transcript: ENSMUST00000030364
SMART Domains Protein: ENSMUSP00000030364
Gene: ENSMUSG00000028621

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:Oxidored-like 15 56 1e-10 PFAM
Pfam:FAD_binding_6 80 156 2.3e-11 PFAM
Pfam:NAD_binding_1 152 266 1.8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106756
SMART Domains Protein: ENSMUSP00000102367
Gene: ENSMUSG00000028621

DomainStartEndE-ValueType
Pfam:FAD_binding_6 20 117 4.7e-23 PFAM
Pfam:NAD_binding_1 127 241 3.2e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106758
SMART Domains Protein: ENSMUSP00000102369
Gene: ENSMUSG00000028621

DomainStartEndE-ValueType
Pfam:Oxidored-like 10 55 1.7e-15 PFAM
Pfam:FAD_binding_6 80 177 8.2e-25 PFAM
Pfam:NAD_binding_1 187 301 8.8e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106760
SMART Domains Protein: ENSMUSP00000102371
Gene: ENSMUSG00000028621

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:Oxidored-like 15 56 2.5e-14 PFAM
Pfam:FAD_binding_6 80 156 3.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126207
SMART Domains Protein: ENSMUSP00000116114
Gene: ENSMUSG00000028621

DomainStartEndE-ValueType
Pfam:Oxidored-like 4 49 1.3e-16 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000127916
AA Change: E41V
Predicted Effect probably benign
Transcript: ENSMUST00000137269
SMART Domains Protein: ENSMUSP00000119249
Gene: ENSMUSG00000028621

DomainStartEndE-ValueType
Pfam:FAD_binding_6 13 110 7.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149453
SMART Domains Protein: ENSMUSP00000121581
Gene: ENSMUSG00000028621

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:Oxidored-like 14 56 5e-15 PFAM
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (75/76)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik A G 17: 9,005,220 N435S probably damaging Het
Aip A T 19: 4,115,381 V195E probably benign Het
Amer3 A T 1: 34,588,788 I703F probably benign Het
Amfr T C 8: 94,012,009 E7G probably benign Het
Angel1 A G 12: 86,726,384 S4P probably damaging Het
Atp2c1 A G 9: 105,464,651 I146T probably damaging Het
Atp6v0e A G 17: 26,695,416 T72A probably benign Het
Bahcc1 T C 11: 120,272,646 V590A possibly damaging Het
Bcl6 A G 16: 23,972,614 V330A possibly damaging Het
Bcl6 T C 16: 23,972,902 D234G probably damaging Het
Btaf1 C T 19: 36,949,102 T58I probably damaging Het
Ccdc175 A T 12: 72,128,409 probably null Het
Cdca4 C A 12: 112,821,569 V180L probably benign Het
Ces1g C A 8: 93,317,037 G425C possibly damaging Het
Chl1 T C 6: 103,706,448 L745P probably damaging Het
Clec4g T A 8: 3,719,518 T42S possibly damaging Het
Ctsg A C 14: 56,100,032 I238S probably damaging Het
Dcdc2a A G 13: 25,107,698 E222G probably benign Het
Dnaaf1 G T 8: 119,596,799 G509V possibly damaging Het
Dnah5 A G 15: 28,453,264 I4394V probably benign Het
Dot1l T G 10: 80,790,726 S1260R probably damaging Het
Dst T G 1: 34,169,260 I1089S probably damaging Het
Eps8l3 A G 3: 107,884,485 probably null Het
Fam135b A G 15: 71,622,068 V4A possibly damaging Het
Fnip2 T C 3: 79,481,006 E806G probably benign Het
Fryl T A 5: 73,073,908 I1609F probably benign Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gm11639 A T 11: 105,008,961 I4350F possibly damaging Het
Gsn A T 2: 35,295,049 K339* probably null Het
Hecw2 T A 1: 53,865,124 Y1155F possibly damaging Het
Kif20b T A 19: 34,974,492 N1723K probably damaging Het
Kif2b T C 11: 91,576,824 D211G probably benign Het
Lhfpl4 C T 6: 113,176,671 V140I probably benign Het
Med16 C T 10: 79,903,343 G203D probably damaging Het
Mrgpra3 T A 7: 47,589,641 Y179F probably benign Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Myo18b A G 5: 112,874,405 S374P unknown Het
Myoz1 A G 14: 20,649,409 I287T possibly damaging Het
Ncoa6 T C 2: 155,438,063 D11G probably benign Het
Nlrp9c A G 7: 26,385,621 Y178H probably damaging Het
Nmur1 T C 1: 86,387,508 T212A probably damaging Het
Oacyl A G 18: 65,720,252 D143G probably benign Het
Obox5 A G 7: 15,758,807 Y229C probably damaging Het
Olfr340 A G 2: 36,452,690 Y35C probably damaging Het
Olfr347 G T 2: 36,734,424 M34I probably benign Het
Olfr54 C A 11: 51,027,601 L200I probably benign Het
Olfr891 A T 9: 38,180,336 C162* probably null Het
Olfr934 A T 9: 38,982,618 M142K probably benign Het
Pcdhb17 A C 18: 37,486,513 N452T probably benign Het
Pear1 T G 3: 87,751,445 H901P probably benign Het
Pi16 A G 17: 29,326,339 Y192C probably damaging Het
Pip5k1b T G 19: 24,358,060 E362D probably damaging Het
Pla2g5 T C 4: 138,804,519 D58G probably damaging Het
Pole T A 5: 110,325,102 probably null Het
Prdm16 G T 4: 154,345,468 T348K probably damaging Het
Prkdc T A 16: 15,689,343 F896I probably damaging Het
Prmt7 T C 8: 106,235,100 F215S unknown Het
Prss23 T A 7: 89,510,184 T226S probably damaging Het
Ptpn14 G A 1: 189,863,398 W739* probably null Het
Rfx5 G T 3: 94,956,539 G135C probably damaging Het
Scmh1 A G 4: 120,525,055 H573R probably benign Het
Serpina5 G T 12: 104,102,295 probably null Het
Sh3rf2 G A 18: 42,104,162 probably null Het
Slc38a2 T C 15: 96,693,301 M229V probably damaging Het
Slc6a17 C G 3: 107,493,148 G222R probably damaging Het
Sp110 C T 1: 85,579,685 G367D possibly damaging Het
Srcap C A 7: 127,539,041 L1128M probably damaging Het
Tmem189 C G 2: 167,661,478 A7P probably benign Het
Tpra1 T A 6: 88,908,294 I76N probably damaging Het
Trav6-4 A T 14: 53,454,592 Y52F probably benign Het
Trp63 C A 16: 25,820,477 H138Q probably damaging Het
Trub2 A G 2: 29,779,826 V177A possibly damaging Het
Ugt2a2 T C 5: 87,460,396 D528G possibly damaging Het
Wnk2 C A 13: 49,102,838 R269L possibly damaging Het
Zc3h12c T A 9: 52,115,926 Q731L possibly damaging Het
Other mutations in Cyb5rl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Cyb5rl APN 4 107084296 missense probably benign 0.21
IGL01350:Cyb5rl APN 4 107084212 missense possibly damaging 0.77
IGL02418:Cyb5rl APN 4 107070985 missense probably damaging 1.00
IGL02746:Cyb5rl APN 4 107068639 missense probably benign 0.12
IGL03088:Cyb5rl APN 4 107081028 nonsense probably null
IGL03279:Cyb5rl APN 4 107084128 missense possibly damaging 0.95
R1301:Cyb5rl UTSW 4 107080907 missense probably damaging 1.00
R1731:Cyb5rl UTSW 4 107080913 missense probably damaging 1.00
R2091:Cyb5rl UTSW 4 107071006 missense probably damaging 1.00
R2165:Cyb5rl UTSW 4 107068683 missense probably damaging 1.00
R2504:Cyb5rl UTSW 4 107080945 missense probably benign 0.01
R4223:Cyb5rl UTSW 4 107080988 missense probably damaging 0.97
R4851:Cyb5rl UTSW 4 107084313 missense probably benign 0.39
R4964:Cyb5rl UTSW 4 107069132 intron probably benign
R5797:Cyb5rl UTSW 4 107084207 missense possibly damaging 0.69
R6575:Cyb5rl UTSW 4 107085353 missense probably benign 0.20
R6688:Cyb5rl UTSW 4 107073905 missense probably damaging 0.99
R6986:Cyb5rl UTSW 4 107070876 missense probably benign 0.18
R7139:Cyb5rl UTSW 4 107071011 missense probably benign 0.35
R7293:Cyb5rl UTSW 4 107080946 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TAGAGACCGAAACAGCCTCTG -3'
(R):5'- GACTTGTCCTTTTACTATGTGCAG -3'

Sequencing Primer
(F):5'- TCTGAGCCACCAAGATCATGTAAGG -3'
(R):5'- TGTGCAGCTTATTCCATTATGAC -3'
Posted On2019-05-15