Incidental Mutation 'R0595:Aldh2'
ID 55056
Institutional Source Beutler Lab
Gene Symbol Aldh2
Ensembl Gene ENSMUSG00000029455
Gene Name aldehyde dehydrogenase 2, mitochondrial
Synonyms Ahd5, Ahd-5
MMRRC Submission 038785-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0595 (G1)
Quality Score 208
Status Validated
Chromosome 5
Chromosomal Location 121704090-121731887 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 121711564 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 276 (A276T)
Ref Sequence ENSEMBL: ENSMUSP00000142906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031411] [ENSMUST00000129753] [ENSMUST00000152945] [ENSMUST00000199369]
AlphaFold P47738
Predicted Effect probably damaging
Transcript: ENSMUST00000031411
AA Change: A276T

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000031411
Gene: ENSMUSG00000029455
AA Change: A276T

DomainStartEndE-ValueType
low complexity region 10 26 N/A INTRINSIC
Pfam:Aldedh 47 510 2.9e-185 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000129753
AA Change: A276T

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000142906
Gene: ENSMUSG00000029455
AA Change: A276T

DomainStartEndE-ValueType
low complexity region 10 26 N/A INTRINSIC
Pfam:Aldedh 47 471 1e-170 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133033
Predicted Effect probably benign
Transcript: ENSMUST00000152945
SMART Domains Protein: ENSMUSP00000123545
Gene: ENSMUSG00000029455

DomainStartEndE-ValueType
low complexity region 10 26 N/A INTRINSIC
Pfam:Aldedh 47 185 1.8e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196694
Predicted Effect probably benign
Transcript: ENSMUST00000199369
SMART Domains Protein: ENSMUSP00000143261
Gene: ENSMUSG00000029455

DomainStartEndE-ValueType
Pfam:Aldedh 1 129 4.2e-43 PFAM
Pfam:Aldedh 125 220 3.6e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200541
Meta Mutation Damage Score 0.5094 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein belongs to the aldehyde dehydrogenase family of proteins. Aldehyde dehydrogenase is the second enzyme of the major oxidative pathway of alcohol metabolism. Two major liver isoforms of aldehyde dehydrogenase, cytosolic and mitochondrial, can be distinguished by their electrophoretic mobilities, kinetic properties, and subcellular localizations. Most Caucasians have two major isozymes, while approximately 50% of East Asians have the cytosolic isozyme but not the mitochondrial isozyme. A remarkably higher frequency of acute alcohol intoxication among East Asians than among Caucasians could be related to the absence of a catalytically active form of the mitochondrial isozyme. The increased exposure to acetaldehyde in individuals with the catalytically inactive form may also confer greater susceptibility to many types of cancer. This gene encodes a mitochondrial isoform, which has a low Km for acetaldehydes, and is localized in mitochondrial matrix. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygous mutation of this gene results in the absence of oxidation activity in the mitochondria. Mice homozygous for a different allele exhibit decreased litter size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T A 5: 8,790,417 (GRCm39) D1093E probably damaging Het
Aldh7a1 C T 18: 56,679,965 (GRCm39) probably benign Het
Ano1 C T 7: 144,143,890 (GRCm39) R964H possibly damaging Het
Apob G A 12: 8,058,369 (GRCm39) V2251I probably benign Het
Atp6v1e1 A G 6: 120,778,091 (GRCm39) V148A probably benign Het
Bbs9 T A 9: 22,408,111 (GRCm39) H73Q probably benign Het
Brca1 A G 11: 101,415,713 (GRCm39) V807A probably benign Het
Cacna1b C T 2: 24,540,001 (GRCm39) probably benign Het
Cadps2 A T 6: 23,321,703 (GRCm39) probably null Het
Cep152 T C 2: 125,436,983 (GRCm39) Q519R probably damaging Het
Cep295 A C 9: 15,243,487 (GRCm39) Y1608* probably null Het
Cfap54 T C 10: 92,720,598 (GRCm39) I2619V unknown Het
Dnajb9 A G 12: 44,255,067 (GRCm39) V7A probably benign Het
Ep400 T C 5: 110,851,408 (GRCm39) K1358R unknown Het
Fbxw7 C A 3: 84,884,674 (GRCm39) probably null Het
Fsip2 T C 2: 82,777,296 (GRCm39) Y108H probably damaging Het
Ggt6 T A 11: 72,328,493 (GRCm39) L331Q probably damaging Het
Ifitm1 T A 7: 140,548,242 (GRCm39) I25N possibly damaging Het
Krt75 C T 15: 101,476,789 (GRCm39) E367K probably damaging Het
Lifr A G 15: 7,206,950 (GRCm39) Y487C probably damaging Het
Map3k6 G T 4: 132,968,574 (GRCm39) G59W probably damaging Het
Mme A G 3: 63,235,602 (GRCm39) T129A probably benign Het
Mmp10 G A 9: 7,508,199 (GRCm39) E442K probably benign Het
Myh13 T C 11: 67,235,672 (GRCm39) S646P probably benign Het
Nbea A T 3: 55,535,917 (GRCm39) I2889N probably benign Het
Nlrp4d T A 7: 10,114,972 (GRCm39) K581N probably benign Het
Nr3c2 C T 8: 77,636,233 (GRCm39) P445S possibly damaging Het
Or5p63 A T 7: 107,810,868 (GRCm39) N289K probably damaging Het
Pck1 T A 2: 172,998,822 (GRCm39) V360E probably damaging Het
Plekha7 T C 7: 115,744,203 (GRCm39) D766G probably damaging Het
Prag1 A G 8: 36,614,156 (GRCm39) N1236S probably damaging Het
Prkdc A C 16: 15,625,952 (GRCm39) Q3326P probably damaging Het
Prrc2b T C 2: 32,073,189 (GRCm39) M57T probably damaging Het
Rb1 A T 14: 73,511,120 (GRCm39) F330I probably damaging Het
Rufy4 A G 1: 74,180,089 (GRCm39) E448G possibly damaging Het
Scn10a T A 9: 119,495,129 (GRCm39) M371L probably benign Het
Sgta T C 10: 80,884,742 (GRCm39) D189G probably damaging Het
Spata31d1b A G 13: 59,864,091 (GRCm39) H413R probably benign Het
Stau2 T C 1: 16,510,674 (GRCm39) T95A probably damaging Het
Supt4a C T 11: 87,633,982 (GRCm39) probably null Het
Tanc2 A G 11: 105,605,003 (GRCm39) probably null Het
Tap2 T A 17: 34,431,328 (GRCm39) V422D probably damaging Het
Tas2r138 A G 6: 40,589,799 (GRCm39) L149P probably damaging Het
Tex15 T C 8: 34,062,645 (GRCm39) S692P probably damaging Het
Tgm2 C T 2: 157,984,962 (GRCm39) R48H probably damaging Het
Ticrr T A 7: 79,345,311 (GRCm39) F1725L possibly damaging Het
Tnpo2 T A 8: 85,778,670 (GRCm39) C672* probably null Het
Xkr9 A G 1: 13,771,008 (GRCm39) I175V probably benign Het
Zfp428 T A 7: 24,214,803 (GRCm39) S140T probably benign Het
Other mutations in Aldh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01813:Aldh2 APN 5 121,710,136 (GRCm39) missense probably benign 0.00
IGL02145:Aldh2 APN 5 121,706,056 (GRCm39) makesense probably null
IGL02352:Aldh2 APN 5 121,713,960 (GRCm39) missense probably null 1.00
IGL02359:Aldh2 APN 5 121,713,960 (GRCm39) missense probably null 1.00
IGL02473:Aldh2 APN 5 121,710,141 (GRCm39) missense probably damaging 1.00
IGL02818:Aldh2 APN 5 121,713,188 (GRCm39) missense probably benign
IGL03182:Aldh2 APN 5 121,718,787 (GRCm39) unclassified probably benign
IGL03324:Aldh2 APN 5 121,713,188 (GRCm39) missense probably benign
Flushed UTSW 5 121,710,879 (GRCm39) nonsense probably null
R0595:Aldh2 UTSW 5 121,711,563 (GRCm39) missense probably damaging 0.99
R1697:Aldh2 UTSW 5 121,716,404 (GRCm39) critical splice donor site probably null
R1992:Aldh2 UTSW 5 121,714,026 (GRCm39) missense possibly damaging 0.93
R2174:Aldh2 UTSW 5 121,710,731 (GRCm39) intron probably benign
R4786:Aldh2 UTSW 5 121,710,887 (GRCm39) missense probably benign 0.21
R4793:Aldh2 UTSW 5 121,707,042 (GRCm39) missense probably damaging 0.99
R5408:Aldh2 UTSW 5 121,708,620 (GRCm39) intron probably benign
R5934:Aldh2 UTSW 5 121,717,678 (GRCm39) missense probably benign
R6266:Aldh2 UTSW 5 121,706,997 (GRCm39) missense probably damaging 0.97
R6294:Aldh2 UTSW 5 121,710,879 (GRCm39) nonsense probably null
R6792:Aldh2 UTSW 5 121,718,712 (GRCm39) missense probably damaging 0.98
R7659:Aldh2 UTSW 5 121,707,023 (GRCm39) missense probably damaging 1.00
R9070:Aldh2 UTSW 5 121,707,032 (GRCm39) missense probably damaging 1.00
R9241:Aldh2 UTSW 5 121,710,220 (GRCm39) missense probably benign 0.00
X0009:Aldh2 UTSW 5 121,710,837 (GRCm39) missense possibly damaging 0.94
X0027:Aldh2 UTSW 5 121,731,525 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGGAGAGAGGTCAATGTCAGACCAC -3'
(R):5'- AACTGGCTATGCGACTTGGCTAC -3'

Sequencing Primer
(F):5'- GTCAATGTCAGACCACACAGG -3'
(R):5'- TGAGTCTGAGTCCCAGCAC -3'
Posted On 2013-07-11