Incidental Mutation 'R7097:Dot1l'
ID550572
Institutional Source Beutler Lab
Gene Symbol Dot1l
Ensembl Gene ENSMUSG00000061589
Gene NameDOT1-like, histone H3 methyltransferase (S. cerevisiae)
SynonymsmDot1, KMT4
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7097 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location80755206-80795461 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 80790726 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 1260 (S1260R)
Ref Sequence ENSEMBL: ENSMUSP00000100973 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105336] [ENSMUST00000127740] [ENSMUST00000149394] [ENSMUST00000150338]
Predicted Effect probably damaging
Transcript: ENSMUST00000105336
AA Change: S1260R

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000100973
Gene: ENSMUSG00000061589
AA Change: S1260R

DomainStartEndE-ValueType
Pfam:DOT1 115 317 9.4e-86 PFAM
low complexity region 335 348 N/A INTRINSIC
AT_hook 407 419 4.64e-1 SMART
low complexity region 437 447 N/A INTRINSIC
coiled coil region 558 647 N/A INTRINSIC
low complexity region 917 936 N/A INTRINSIC
low complexity region 948 961 N/A INTRINSIC
low complexity region 1084 1095 N/A INTRINSIC
low complexity region 1145 1157 N/A INTRINSIC
low complexity region 1186 1198 N/A INTRINSIC
low complexity region 1436 1446 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127740
Predicted Effect probably benign
Transcript: ENSMUST00000138505
SMART Domains Protein: ENSMUSP00000119492
Gene: ENSMUSG00000061589

DomainStartEndE-ValueType
low complexity region 24 43 N/A INTRINSIC
low complexity region 52 64 N/A INTRINSIC
low complexity region 73 87 N/A INTRINSIC
low complexity region 92 137 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000149394
AA Change: S139R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127762
Gene: ENSMUSG00000061589
AA Change: S139R

DomainStartEndE-ValueType
low complexity region 24 36 N/A INTRINSIC
low complexity region 65 77 N/A INTRINSIC
low complexity region 315 325 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150338
SMART Domains Protein: ENSMUSP00000116581
Gene: ENSMUSG00000061589

DomainStartEndE-ValueType
Pfam:DOT1 1 100 3.4e-37 PFAM
low complexity region 118 131 N/A INTRINSIC
AT_hook 190 202 4.64e-1 SMART
low complexity region 220 230 N/A INTRINSIC
low complexity region 371 390 N/A INTRINSIC
SCOP:d1fxkc_ 396 441 1e-3 SMART
low complexity region 700 719 N/A INTRINSIC
low complexity region 731 744 N/A INTRINSIC
low complexity region 867 878 N/A INTRINSIC
low complexity region 928 940 N/A INTRINSIC
low complexity region 969 981 N/A INTRINSIC
low complexity region 1020 1032 N/A INTRINSIC
low complexity region 1041 1055 N/A INTRINSIC
low complexity region 1060 1105 N/A INTRINSIC
low complexity region 1157 1174 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a histone methyltransferase that methylates lysine-79 of histone H3. It is inactive against free core histones, but shows significant histone methyltransferase activity against nucleosomes. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a gene trap allele show late embryonic lethality. Mice homozygous for a null allele die by E10.5 displaying a growth arrest, abnormal yolk sac angiogenesis and heart dilation while mutant ES cells show elevated apoptosis, G2 cell cycle arrest, telomere elongation and aneuploidy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik A G 17: 9,005,220 N435S probably damaging Het
Aip A T 19: 4,115,381 V195E probably benign Het
Amer3 A T 1: 34,588,788 I703F probably benign Het
Amfr T C 8: 94,012,009 E7G probably benign Het
Angel1 A G 12: 86,726,384 S4P probably damaging Het
Atp2c1 A G 9: 105,464,651 I146T probably damaging Het
Atp6v0e A G 17: 26,695,416 T72A probably benign Het
Bahcc1 T C 11: 120,272,646 V590A possibly damaging Het
Bcl6 A G 16: 23,972,614 V330A possibly damaging Het
Bcl6 T C 16: 23,972,902 D234G probably damaging Het
Btaf1 C T 19: 36,949,102 T58I probably damaging Het
Ccdc175 A T 12: 72,128,409 probably null Het
Cdca4 C A 12: 112,821,569 V180L probably benign Het
Ces1g C A 8: 93,317,037 G425C possibly damaging Het
Chl1 T C 6: 103,706,448 L745P probably damaging Het
Clec4g T A 8: 3,719,518 T42S possibly damaging Het
Ctsg A C 14: 56,100,032 I238S probably damaging Het
Cyb5rl A T 4: 107,087,316 E41V unknown Het
Dcdc2a A G 13: 25,107,698 E222G probably benign Het
Dnaaf1 G T 8: 119,596,799 G509V possibly damaging Het
Dnah5 A G 15: 28,453,264 I4394V probably benign Het
Dst T G 1: 34,169,260 I1089S probably damaging Het
Eps8l3 A G 3: 107,884,485 probably null Het
Fam135b A G 15: 71,622,068 V4A possibly damaging Het
Fnip2 T C 3: 79,481,006 E806G probably benign Het
Fryl T A 5: 73,073,908 I1609F probably benign Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gm11639 A T 11: 105,008,961 I4350F possibly damaging Het
Gsn A T 2: 35,295,049 K339* probably null Het
Hecw2 T A 1: 53,865,124 Y1155F possibly damaging Het
Kif20b T A 19: 34,974,492 N1723K probably damaging Het
Kif2b T C 11: 91,576,824 D211G probably benign Het
Lhfpl4 C T 6: 113,176,671 V140I probably benign Het
Med16 C T 10: 79,903,343 G203D probably damaging Het
Mrgpra3 T A 7: 47,589,641 Y179F probably benign Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Myo18b A G 5: 112,874,405 S374P unknown Het
Myoz1 A G 14: 20,649,409 I287T possibly damaging Het
Ncoa6 T C 2: 155,438,063 D11G probably benign Het
Nlrp9c A G 7: 26,385,621 Y178H probably damaging Het
Nmur1 T C 1: 86,387,508 T212A probably damaging Het
Oacyl A G 18: 65,720,252 D143G probably benign Het
Obox5 A G 7: 15,758,807 Y229C probably damaging Het
Olfr340 A G 2: 36,452,690 Y35C probably damaging Het
Olfr347 G T 2: 36,734,424 M34I probably benign Het
Olfr54 C A 11: 51,027,601 L200I probably benign Het
Olfr891 A T 9: 38,180,336 C162* probably null Het
Olfr934 A T 9: 38,982,618 M142K probably benign Het
Pcdhb17 A C 18: 37,486,513 N452T probably benign Het
Pear1 T G 3: 87,751,445 H901P probably benign Het
Pi16 A G 17: 29,326,339 Y192C probably damaging Het
Pip5k1b T G 19: 24,358,060 E362D probably damaging Het
Pla2g5 T C 4: 138,804,519 D58G probably damaging Het
Pole T A 5: 110,325,102 probably null Het
Prdm16 G T 4: 154,345,468 T348K probably damaging Het
Prkdc T A 16: 15,689,343 F896I probably damaging Het
Prmt7 T C 8: 106,235,100 F215S unknown Het
Prss23 T A 7: 89,510,184 T226S probably damaging Het
Ptpn14 G A 1: 189,863,398 W739* probably null Het
Rfx5 G T 3: 94,956,539 G135C probably damaging Het
Scmh1 A G 4: 120,525,055 H573R probably benign Het
Serpina5 G T 12: 104,102,295 probably null Het
Sh3rf2 G A 18: 42,104,162 probably null Het
Slc38a2 T C 15: 96,693,301 M229V probably damaging Het
Slc6a17 C G 3: 107,493,148 G222R probably damaging Het
Sp110 C T 1: 85,579,685 G367D possibly damaging Het
Srcap C A 7: 127,539,041 L1128M probably damaging Het
Tmem189 C G 2: 167,661,478 A7P probably benign Het
Tpra1 T A 6: 88,908,294 I76N probably damaging Het
Trav6-4 A T 14: 53,454,592 Y52F probably benign Het
Trp63 C A 16: 25,820,477 H138Q probably damaging Het
Trub2 A G 2: 29,779,826 V177A possibly damaging Het
Ugt2a2 T C 5: 87,460,396 D528G possibly damaging Het
Wnk2 C A 13: 49,102,838 R269L possibly damaging Het
Zc3h12c T A 9: 52,115,926 Q731L possibly damaging Het
Other mutations in Dot1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01836:Dot1l APN 10 80785866 missense probably benign 0.00
IGL01915:Dot1l APN 10 80780894 missense probably damaging 0.99
IGL02287:Dot1l APN 10 80764609 missense possibly damaging 0.66
IGL02695:Dot1l APN 10 80777608 missense probably damaging 1.00
IGL03058:Dot1l APN 10 80790997 missense probably benign 0.00
IGL03071:Dot1l APN 10 80788679 missense probably benign 0.00
IGL03120:Dot1l APN 10 80786273 splice site probably benign
R0220:Dot1l UTSW 10 80785858 missense probably damaging 0.99
R1342:Dot1l UTSW 10 80786025 missense probably benign 0.14
R1701:Dot1l UTSW 10 80790742 missense possibly damaging 0.93
R1862:Dot1l UTSW 10 80783539 missense probably damaging 1.00
R2094:Dot1l UTSW 10 80785878 missense probably damaging 1.00
R2308:Dot1l UTSW 10 80789069 missense probably damaging 1.00
R4274:Dot1l UTSW 10 80783988 critical splice donor site probably null
R4617:Dot1l UTSW 10 80785084 missense probably damaging 0.97
R4623:Dot1l UTSW 10 80782150 missense probably benign 0.18
R4690:Dot1l UTSW 10 80786182 nonsense probably null
R5009:Dot1l UTSW 10 80771196 missense probably benign 0.25
R5072:Dot1l UTSW 10 80784646 missense possibly damaging 0.83
R5073:Dot1l UTSW 10 80784646 missense possibly damaging 0.83
R5074:Dot1l UTSW 10 80784646 missense possibly damaging 0.83
R5305:Dot1l UTSW 10 80790793 missense probably benign 0.03
R5312:Dot1l UTSW 10 80784637 missense possibly damaging 0.94
R5512:Dot1l UTSW 10 80788991 missense possibly damaging 0.92
R5551:Dot1l UTSW 10 80783628 small deletion probably benign
R5552:Dot1l UTSW 10 80783628 small deletion probably benign
R5553:Dot1l UTSW 10 80783628 small deletion probably benign
R6056:Dot1l UTSW 10 80786095 missense probably damaging 0.96
R6207:Dot1l UTSW 10 80786443 missense probably benign 0.06
R6419:Dot1l UTSW 10 80791481 missense possibly damaging 0.85
R6782:Dot1l UTSW 10 80789390 missense probably damaging 1.00
R7054:Dot1l UTSW 10 80787023 missense probably damaging 0.99
R7071:Dot1l UTSW 10 80792245 missense probably benign 0.01
R7131:Dot1l UTSW 10 80792341 missense unknown
R7459:Dot1l UTSW 10 80773173 missense probably damaging 0.96
R7687:Dot1l UTSW 10 80789368 missense possibly damaging 0.70
R7741:Dot1l UTSW 10 80783544 missense probably damaging 1.00
X0066:Dot1l UTSW 10 80788683 missense possibly damaging 0.94
X0066:Dot1l UTSW 10 80788684 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGTTGCATGCACCTCTTAG -3'
(R):5'- AAACCGAGGTCTGCAGCAAG -3'

Sequencing Primer
(F):5'- AGCTGTCTTCACCCCAGGAAG -3'
(R):5'- AAGGCCCCCACTGAAGG -3'
Posted On2019-05-15