Incidental Mutation 'R7097:Bcl6'
ID550590
Institutional Source Beutler Lab
Gene Symbol Bcl6
Ensembl Gene ENSMUSG00000022508
Gene NameB cell leukemia/lymphoma 6
SynonymsBcl5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock #R7097 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location23965052-23988852 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23972902 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 234 (D234G)
Ref Sequence ENSEMBL: ENSMUSP00000023151 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023151]
Predicted Effect probably damaging
Transcript: ENSMUST00000023151
AA Change: D234G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000023151
Gene: ENSMUSG00000022508
AA Change: D234G

DomainStartEndE-ValueType
BTB 32 129 4.86e-28 SMART
low complexity region 406 422 N/A INTRINSIC
low complexity region 458 467 N/A INTRINSIC
ZnF_C2H2 519 542 1.33e-1 SMART
ZnF_C2H2 547 569 1.67e-2 SMART
ZnF_C2H2 575 597 2.79e-4 SMART
ZnF_C2H2 603 625 3.89e-3 SMART
ZnF_C2H2 631 653 8.47e-4 SMART
ZnF_C2H2 659 682 4.11e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcription factor and contains an N-terminal POZ domain. This protein acts as a sequence-specific repressor of transcription, and has been shown to modulate the transcription of STAT-dependent IL-4 responses of B cells. This protein can interact with a variety of POZ-containing proteins that function as transcription corepressors. This gene is found to be frequently translocated and hypermutated in diffuse large-cell lymphoma (DLCL), and may be involved in the pathogenesis of DLCL. Alternatively spliced transcript variants encoding different protein isoforms have been found for this gene. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mutants develop myocarditis and pulmonary vasculitis, show impaired germinal center formation in the spleen, and display T helper 2 cell hyperimmune responsiveness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik A G 17: 9,005,220 N435S probably damaging Het
Aip A T 19: 4,115,381 V195E probably benign Het
Amer3 A T 1: 34,588,788 I703F probably benign Het
Amfr T C 8: 94,012,009 E7G probably benign Het
Angel1 A G 12: 86,726,384 S4P probably damaging Het
Atp2c1 A G 9: 105,464,651 I146T probably damaging Het
Atp6v0e A G 17: 26,695,416 T72A probably benign Het
Bahcc1 T C 11: 120,272,646 V590A possibly damaging Het
Btaf1 C T 19: 36,949,102 T58I probably damaging Het
Ccdc175 A T 12: 72,128,409 probably null Het
Cdca4 C A 12: 112,821,569 V180L probably benign Het
Ces1g C A 8: 93,317,037 G425C possibly damaging Het
Chl1 T C 6: 103,706,448 L745P probably damaging Het
Clec4g T A 8: 3,719,518 T42S possibly damaging Het
Ctsg A C 14: 56,100,032 I238S probably damaging Het
Cyb5rl A T 4: 107,087,316 E41V unknown Het
Dcdc2a A G 13: 25,107,698 E222G probably benign Het
Dnaaf1 G T 8: 119,596,799 G509V possibly damaging Het
Dnah5 A G 15: 28,453,264 I4394V probably benign Het
Dot1l T G 10: 80,790,726 S1260R probably damaging Het
Dst T G 1: 34,169,260 I1089S probably damaging Het
Eps8l3 A G 3: 107,884,485 probably null Het
Fam135b A G 15: 71,622,068 V4A possibly damaging Het
Fnip2 T C 3: 79,481,006 E806G probably benign Het
Fryl T A 5: 73,073,908 I1609F probably benign Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gm11639 A T 11: 105,008,961 I4350F possibly damaging Het
Gsn A T 2: 35,295,049 K339* probably null Het
Hecw2 T A 1: 53,865,124 Y1155F possibly damaging Het
Kif20b T A 19: 34,974,492 N1723K probably damaging Het
Kif2b T C 11: 91,576,824 D211G probably benign Het
Lhfpl4 C T 6: 113,176,671 V140I probably benign Het
Med16 C T 10: 79,903,343 G203D probably damaging Het
Mrgpra3 T A 7: 47,589,641 Y179F probably benign Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Myo18b A G 5: 112,874,405 S374P unknown Het
Myoz1 A G 14: 20,649,409 I287T possibly damaging Het
Ncoa6 T C 2: 155,438,063 D11G probably benign Het
Nlrp9c A G 7: 26,385,621 Y178H probably damaging Het
Nmur1 T C 1: 86,387,508 T212A probably damaging Het
Oacyl A G 18: 65,720,252 D143G probably benign Het
Obox5 A G 7: 15,758,807 Y229C probably damaging Het
Olfr340 A G 2: 36,452,690 Y35C probably damaging Het
Olfr347 G T 2: 36,734,424 M34I probably benign Het
Olfr54 C A 11: 51,027,601 L200I probably benign Het
Olfr891 A T 9: 38,180,336 C162* probably null Het
Olfr934 A T 9: 38,982,618 M142K probably benign Het
Pcdhb17 A C 18: 37,486,513 N452T probably benign Het
Pear1 T G 3: 87,751,445 H901P probably benign Het
Pi16 A G 17: 29,326,339 Y192C probably damaging Het
Pip5k1b T G 19: 24,358,060 E362D probably damaging Het
Pla2g5 T C 4: 138,804,519 D58G probably damaging Het
Pole T A 5: 110,325,102 probably null Het
Prdm16 G T 4: 154,345,468 T348K probably damaging Het
Prkdc T A 16: 15,689,343 F896I probably damaging Het
Prmt7 T C 8: 106,235,100 F215S unknown Het
Prss23 T A 7: 89,510,184 T226S probably damaging Het
Ptpn14 G A 1: 189,863,398 W739* probably null Het
Rfx5 G T 3: 94,956,539 G135C probably damaging Het
Scmh1 A G 4: 120,525,055 H573R probably benign Het
Serpina5 G T 12: 104,102,295 probably null Het
Sh3rf2 G A 18: 42,104,162 probably null Het
Slc38a2 T C 15: 96,693,301 M229V probably damaging Het
Slc6a17 C G 3: 107,493,148 G222R probably damaging Het
Sp110 C T 1: 85,579,685 G367D possibly damaging Het
Srcap C A 7: 127,539,041 L1128M probably damaging Het
Tmem189 C G 2: 167,661,478 A7P probably benign Het
Tpra1 T A 6: 88,908,294 I76N probably damaging Het
Trav6-4 A T 14: 53,454,592 Y52F probably benign Het
Trp63 C A 16: 25,820,477 H138Q probably damaging Het
Trub2 A G 2: 29,779,826 V177A possibly damaging Het
Ugt2a2 T C 5: 87,460,396 D528G possibly damaging Het
Wnk2 C A 13: 49,102,838 R269L possibly damaging Het
Zc3h12c T A 9: 52,115,926 Q731L possibly damaging Het
Other mutations in Bcl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02220:Bcl6 APN 16 23974891 missense probably damaging 1.00
IGL02505:Bcl6 APN 16 23977569 missense probably damaging 1.00
IGL03052:Bcl6 APN 16 23975038 splice site probably benign
IGL03271:Bcl6 APN 16 23970006 missense probably benign 0.00
Adriatic UTSW 16 23968133 missense probably damaging 0.99
Catanzaro UTSW 16 23966226 nonsense probably null
Density UTSW 16 23970048 missense possibly damaging 0.91
nouvelle UTSW 16 23969986 missense possibly damaging 0.92
R0220:Bcl6 UTSW 16 23966219 missense possibly damaging 0.95
R0401:Bcl6 UTSW 16 23972594 missense probably damaging 0.97
R0734:Bcl6 UTSW 16 23968139 missense probably damaging 0.99
R1105:Bcl6 UTSW 16 23966155 missense probably benign
R1134:Bcl6 UTSW 16 23968365 missense probably benign
R1317:Bcl6 UTSW 16 23977542 missense probably damaging 1.00
R1325:Bcl6 UTSW 16 23972347 missense probably benign 0.02
R1393:Bcl6 UTSW 16 23977566 missense probably damaging 0.99
R1761:Bcl6 UTSW 16 23977542 missense probably damaging 1.00
R2170:Bcl6 UTSW 16 23974930 missense probably damaging 1.00
R2220:Bcl6 UTSW 16 23972632 nonsense probably null
R2293:Bcl6 UTSW 16 23977609 missense probably damaging 0.98
R2907:Bcl6 UTSW 16 23968119 missense probably damaging 1.00
R3900:Bcl6 UTSW 16 23977554 missense possibly damaging 0.94
R4681:Bcl6 UTSW 16 23968453 intron probably benign
R5015:Bcl6 UTSW 16 23974850 missense probably damaging 0.98
R5112:Bcl6 UTSW 16 23972746 missense probably benign
R5185:Bcl6 UTSW 16 23972947 missense possibly damaging 0.77
R5371:Bcl6 UTSW 16 23969986 missense possibly damaging 0.92
R5586:Bcl6 UTSW 16 23973176 missense probably benign 0.01
R5659:Bcl6 UTSW 16 23968409 nonsense probably null
R5909:Bcl6 UTSW 16 23972806 missense probably benign
R6384:Bcl6 UTSW 16 23974865 missense probably damaging 1.00
R7036:Bcl6 UTSW 16 23974861 missense probably damaging 1.00
R7097:Bcl6 UTSW 16 23972614 missense possibly damaging 0.94
R7122:Bcl6 UTSW 16 23972902 missense probably damaging 1.00
R7153:Bcl6 UTSW 16 23966226 nonsense probably null
R7154:Bcl6 UTSW 16 23966226 nonsense probably null
R7155:Bcl6 UTSW 16 23966226 nonsense probably null
R7156:Bcl6 UTSW 16 23966226 nonsense probably null
R7163:Bcl6 UTSW 16 23966226 nonsense probably null
R7164:Bcl6 UTSW 16 23966226 nonsense probably null
R7434:Bcl6 UTSW 16 23970048 missense possibly damaging 0.91
R7727:Bcl6 UTSW 16 23971413 critical splice donor site probably null
R7914:Bcl6 UTSW 16 23970011 missense possibly damaging 0.68
R8230:Bcl6 UTSW 16 23972902 missense probably damaging 1.00
R8243:Bcl6 UTSW 16 23968133 missense probably damaging 0.99
R8399:Bcl6 UTSW 16 23972948 missense probably benign 0.39
Z1176:Bcl6 UTSW 16 23969958 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGGGAAGTATGGAGCATTCC -3'
(R):5'- GTCGTGGAGAACAATATGCCAC -3'

Sequencing Primer
(F):5'- CATTCCGAGCAGAAGGGAC -3'
(R):5'- CACTGAGAAATACTCCCGGGTGTG -3'
Posted On2019-05-15