Incidental Mutation 'R7097:Atp6v0e'
ID550593
Institutional Source Beutler Lab
Gene Symbol Atp6v0e
Ensembl Gene ENSMUSG00000015575
Gene NameATPase, H+ transporting, lysosomal V0 subunit E
Synonymslysosomal 9kDa, Atp6k, M9.2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.314) question?
Stock #R7097 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location26676396-26699644 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26695416 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 72 (T72A)
Ref Sequence ENSEMBL: ENSMUSP00000015719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015719] [ENSMUST00000167352]
Predicted Effect probably benign
Transcript: ENSMUST00000015719
AA Change: T72A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000015719
Gene: ENSMUSG00000015575
AA Change: T72A

DomainStartEndE-ValueType
Pfam:ATP_synt_H 8 72 6.2e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167352
AA Change: T72A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000127552
Gene: ENSMUSG00000015575
AA Change: T72A

DomainStartEndE-ValueType
Pfam:ATP_synt_H 8 72 6.2e-30 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c", and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This encoded protein is possibly part of the V0 subunit. Since two nontranscribed pseudogenes have been found in dog, it is possible that the localization to chromosome 2 for this gene by radiation hybrid mapping is representing a pseudogene. Genomic mapping puts the chromosomal location on 5q35.3. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik A G 17: 9,005,220 N435S probably damaging Het
Aip A T 19: 4,115,381 V195E probably benign Het
Amer3 A T 1: 34,588,788 I703F probably benign Het
Amfr T C 8: 94,012,009 E7G probably benign Het
Angel1 A G 12: 86,726,384 S4P probably damaging Het
Atp2c1 A G 9: 105,464,651 I146T probably damaging Het
Bahcc1 T C 11: 120,272,646 V590A possibly damaging Het
Bcl6 A G 16: 23,972,614 V330A possibly damaging Het
Bcl6 T C 16: 23,972,902 D234G probably damaging Het
Btaf1 C T 19: 36,949,102 T58I probably damaging Het
Ccdc175 A T 12: 72,128,409 probably null Het
Cdca4 C A 12: 112,821,569 V180L probably benign Het
Ces1g C A 8: 93,317,037 G425C possibly damaging Het
Chl1 T C 6: 103,706,448 L745P probably damaging Het
Clec4g T A 8: 3,719,518 T42S possibly damaging Het
Ctsg A C 14: 56,100,032 I238S probably damaging Het
Cyb5rl A T 4: 107,087,316 E41V unknown Het
Dcdc2a A G 13: 25,107,698 E222G probably benign Het
Dnaaf1 G T 8: 119,596,799 G509V possibly damaging Het
Dnah5 A G 15: 28,453,264 I4394V probably benign Het
Dot1l T G 10: 80,790,726 S1260R probably damaging Het
Dst T G 1: 34,169,260 I1089S probably damaging Het
Eps8l3 A G 3: 107,884,485 probably null Het
Fam135b A G 15: 71,622,068 V4A possibly damaging Het
Fnip2 T C 3: 79,481,006 E806G probably benign Het
Fryl T A 5: 73,073,908 I1609F probably benign Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gm11639 A T 11: 105,008,961 I4350F possibly damaging Het
Gsn A T 2: 35,295,049 K339* probably null Het
Hecw2 T A 1: 53,865,124 Y1155F possibly damaging Het
Kif20b T A 19: 34,974,492 N1723K probably damaging Het
Kif2b T C 11: 91,576,824 D211G probably benign Het
Lhfpl4 C T 6: 113,176,671 V140I probably benign Het
Med16 C T 10: 79,903,343 G203D probably damaging Het
Mrgpra3 T A 7: 47,589,641 Y179F probably benign Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Myo18b A G 5: 112,874,405 S374P unknown Het
Myoz1 A G 14: 20,649,409 I287T possibly damaging Het
Ncoa6 T C 2: 155,438,063 D11G probably benign Het
Nlrp9c A G 7: 26,385,621 Y178H probably damaging Het
Nmur1 T C 1: 86,387,508 T212A probably damaging Het
Oacyl A G 18: 65,720,252 D143G probably benign Het
Obox5 A G 7: 15,758,807 Y229C probably damaging Het
Olfr340 A G 2: 36,452,690 Y35C probably damaging Het
Olfr347 G T 2: 36,734,424 M34I probably benign Het
Olfr54 C A 11: 51,027,601 L200I probably benign Het
Olfr891 A T 9: 38,180,336 C162* probably null Het
Olfr934 A T 9: 38,982,618 M142K probably benign Het
Pcdhb17 A C 18: 37,486,513 N452T probably benign Het
Pear1 T G 3: 87,751,445 H901P probably benign Het
Pi16 A G 17: 29,326,339 Y192C probably damaging Het
Pip5k1b T G 19: 24,358,060 E362D probably damaging Het
Pla2g5 T C 4: 138,804,519 D58G probably damaging Het
Pole T A 5: 110,325,102 probably null Het
Prdm16 G T 4: 154,345,468 T348K probably damaging Het
Prkdc T A 16: 15,689,343 F896I probably damaging Het
Prmt7 T C 8: 106,235,100 F215S unknown Het
Prss23 T A 7: 89,510,184 T226S probably damaging Het
Ptpn14 G A 1: 189,863,398 W739* probably null Het
Rfx5 G T 3: 94,956,539 G135C probably damaging Het
Scmh1 A G 4: 120,525,055 H573R probably benign Het
Serpina5 G T 12: 104,102,295 probably null Het
Sh3rf2 G A 18: 42,104,162 probably null Het
Slc38a2 T C 15: 96,693,301 M229V probably damaging Het
Slc6a17 C G 3: 107,493,148 G222R probably damaging Het
Sp110 C T 1: 85,579,685 G367D possibly damaging Het
Srcap C A 7: 127,539,041 L1128M probably damaging Het
Tmem189 C G 2: 167,661,478 A7P probably benign Het
Tpra1 T A 6: 88,908,294 I76N probably damaging Het
Trav6-4 A T 14: 53,454,592 Y52F probably benign Het
Trp63 C A 16: 25,820,477 H138Q probably damaging Het
Trub2 A G 2: 29,779,826 V177A possibly damaging Het
Ugt2a2 T C 5: 87,460,396 D528G possibly damaging Het
Wnk2 C A 13: 49,102,838 R269L possibly damaging Het
Zc3h12c T A 9: 52,115,926 Q731L possibly damaging Het
Other mutations in Atp6v0e
AlleleSourceChrCoordTypePredicted EffectPPH Score
R6265:Atp6v0e UTSW 17 26676533 missense possibly damaging 0.91
R7122:Atp6v0e UTSW 17 26695416 missense probably benign 0.03
R7432:Atp6v0e UTSW 17 26682698 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CCCAGGAGAACAATGTGTAGTG -3'
(R):5'- TAAACCAGTCTACTCTTCGGC -3'

Sequencing Primer
(F):5'- GAAGGCTTTGTCTGAATGGACTACAC -3'
(R):5'- CTATCTCAGCTGTCTTTAAATGGC -3'
Posted On2019-05-15