Incidental Mutation 'R7098:Frmd4a'
ID550609
Institutional Source Beutler Lab
Gene Symbol Frmd4a
Ensembl Gene ENSMUSG00000026657
Gene NameFERM domain containing 4A
SynonymsGm13190, 2700017I06Rik, C230040M21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R7098 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location4017717-4614043 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4572433 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 367 (S367P)
Ref Sequence ENSEMBL: ENSMUSP00000089079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075767] [ENSMUST00000091497] [ENSMUST00000175669] [ENSMUST00000175944] [ENSMUST00000176828] [ENSMUST00000176864] [ENSMUST00000177457]
Predicted Effect probably damaging
Transcript: ENSMUST00000075767
AA Change: S356P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075172
Gene: ENSMUSG00000026657
AA Change: S356P

DomainStartEndE-ValueType
B41 1 206 3.24e-40 SMART
FERM_C 210 311 7.69e-27 SMART
Pfam:DUF3338 340 477 1.9e-63 PFAM
low complexity region 558 571 N/A INTRINSIC
low complexity region 610 623 N/A INTRINSIC
low complexity region 732 741 N/A INTRINSIC
low complexity region 764 785 N/A INTRINSIC
low complexity region 790 801 N/A INTRINSIC
low complexity region 924 947 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000091497
AA Change: S367P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000089079
Gene: ENSMUSG00000026657
AA Change: S367P

DomainStartEndE-ValueType
B41 12 217 3.24e-40 SMART
FERM_C 221 322 7.69e-27 SMART
Pfam:DUF3338 352 487 6.3e-61 PFAM
low complexity region 569 582 N/A INTRINSIC
low complexity region 621 634 N/A INTRINSIC
low complexity region 743 752 N/A INTRINSIC
low complexity region 775 796 N/A INTRINSIC
low complexity region 801 812 N/A INTRINSIC
low complexity region 935 958 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000175669
AA Change: S386P
SMART Domains Protein: ENSMUSP00000135306
Gene: ENSMUSG00000026657
AA Change: S386P

DomainStartEndE-ValueType
B41 31 236 3.24e-40 SMART
FERM_C 240 341 7.69e-27 SMART
low complexity region 371 387 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000175944
AA Change: S404P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135686
Gene: ENSMUSG00000026657
AA Change: S404P

DomainStartEndE-ValueType
B41 49 254 3.24e-40 SMART
FERM_C 258 359 7.69e-27 SMART
Pfam:DUF3338 388 525 6.5e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176828
AA Change: S62P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134803
Gene: ENSMUSG00000026657
AA Change: S62P

DomainStartEndE-ValueType
Pfam:DUF3338 46 183 4.1e-64 PFAM
low complexity region 264 277 N/A INTRINSIC
low complexity region 316 329 N/A INTRINSIC
low complexity region 438 447 N/A INTRINSIC
low complexity region 470 491 N/A INTRINSIC
low complexity region 496 507 N/A INTRINSIC
low complexity region 630 653 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000176864
AA Change: S51P

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135057
Gene: ENSMUSG00000026657
AA Change: S51P

DomainStartEndE-ValueType
Pfam:DUF3338 35 150 2.6e-50 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177457
AA Change: S371P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134788
Gene: ENSMUSG00000026657
AA Change: S371P

DomainStartEndE-ValueType
B41 16 221 3.24e-40 SMART
FERM_C 225 326 7.69e-27 SMART
Pfam:DUF3338 355 492 3.9e-63 PFAM
low complexity region 573 586 N/A INTRINSIC
low complexity region 625 638 N/A INTRINSIC
low complexity region 747 756 N/A INTRINSIC
low complexity region 779 800 N/A INTRINSIC
low complexity region 805 816 N/A INTRINSIC
low complexity region 939 962 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a FERM domain-containing protein that regulates epithelial cell polarity. It connects ADP ribosylation factor 6 (ARF6) with the Par protein complex, which regulates the remodeling of adherens junctions and linear actin cable formation during epithelial cell polarization. Polymorphisms in this gene are associated with Alzheimer's disease, and also with nicotine dependence. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik T A 5: 138,646,522 M223K probably benign Het
Abce1 T C 8: 79,686,049 T550A probably benign Het
Acoxl C T 2: 127,854,915 Q28* probably null Het
Adam8 T C 7: 139,979,499 K820R possibly damaging Het
Adamts3 G T 5: 89,861,495 A103D probably damaging Het
Apba2 T A 7: 64,736,948 V441D probably damaging Het
Arap2 A G 5: 62,675,950 probably null Het
Arhgef10l T A 4: 140,580,911 M44L probably benign Het
Asb4 T C 6: 5,398,499 C155R probably damaging Het
Bpifb6 A T 2: 153,906,890 K269* probably null Het
Cc2d2a A T 5: 43,683,139 T161S probably benign Het
Ccdc15 T A 9: 37,343,960 Q98L probably damaging Het
Col19a1 A G 1: 24,526,474 S259P unknown Het
Col5a2 A T 1: 45,380,067 D1284E possibly damaging Het
Cyp2c70 T C 19: 40,180,487 T119A probably benign Het
Dennd6b C T 15: 89,188,687 C188Y probably damaging Het
Dhx8 T A 11: 101,737,768 probably null Het
Dhx9 T C 1: 153,465,022 K624R probably benign Het
Dpys C T 15: 39,793,331 V447M probably damaging Het
E130308A19Rik T C 4: 59,753,004 S706P possibly damaging Het
Esrrb A G 12: 86,470,415 D107G probably benign Het
Fam71d G A 12: 78,719,634 probably null Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gm136 T C 4: 34,746,628 I128V probably benign Het
Gm6525 T A 3: 84,175,002 C77S possibly damaging Het
Grid2ip T C 5: 143,357,591 F14S probably damaging Het
Hdhd3 C T 4: 62,499,915 R8H probably damaging Het
Kdelr1 C A 7: 45,874,056 A69D possibly damaging Het
Krtap16-3 T A 16: 88,962,672 Y51F unknown Het
Lrrc40 T A 3: 158,041,639 N129K probably benign Het
Man1b1 T A 2: 25,338,184 D155E probably damaging Het
Mcm5 T C 8: 75,120,901 V442A probably damaging Het
Mfsd14a C T 3: 116,641,712 A235T probably benign Het
Mmp1a C A 9: 7,475,937 T401K probably benign Het
Mpig6b C T 17: 35,064,344 R196Q unknown Het
Mroh1 C T 15: 76,408,457 Q262* probably null Het
Msh3 A T 13: 92,274,111 D656E possibly damaging Het
Muc4 A T 16: 32,757,091 T252S Het
Myh15 C T 16: 49,177,057 A1746V possibly damaging Het
Myh8 C A 11: 67,279,053 T66K probably benign Het
Nemf A T 12: 69,312,467 Y999N probably damaging Het
Neurod1 T C 2: 79,454,685 N118S probably damaging Het
Nlrp1b T A 11: 71,218,274 I134L possibly damaging Het
Nsun7 A T 5: 66,260,983 I19F probably damaging Het
Ofcc1 A G 13: 40,003,966 probably null Het
P2rx7 A G 5: 122,673,793 E389G probably damaging Het
Pam C T 1: 97,898,347 R194H probably benign Het
Pcnt A G 10: 76,384,839 S2052P probably benign Het
Pfkfb4 T A 9: 108,999,154 Y86N probably benign Het
Plcd3 T A 11: 103,077,863 D334V probably damaging Het
Ppard T C 17: 28,298,813 V285A possibly damaging Het
Prune2 A G 19: 17,120,602 S1157G probably benign Het
Psg21 A T 7: 18,652,545 L172H probably damaging Het
Psme4 C A 11: 30,850,661 T1417K probably damaging Het
Ptprc T C 1: 138,099,685 D336G probably benign Het
Ralgapa1 A T 12: 55,790,310 probably null Het
Rap1gap C A 4: 137,716,082 probably null Het
Scap T C 9: 110,372,242 S100P possibly damaging Het
Scpep1 T C 11: 88,929,185 I426V possibly damaging Het
Sdk1 T C 5: 142,096,870 I1341T probably damaging Het
Sfmbt2 T A 2: 10,579,189 Y786N probably benign Het
Sh3tc1 A T 5: 35,702,014 probably null Het
Slc5a5 T A 8: 70,888,538 I386F probably damaging Het
Smarca4 T G 9: 21,634,820 M98R probably benign Het
St18 G A 1: 6,827,842 D623N probably damaging Het
Sult2a1 A T 7: 13,816,053 probably null Het
Tgfb2 C T 1: 186,630,637 R330H probably damaging Het
Thoc3 A G 13: 54,466,306 I168T probably damaging Het
Tmem126a C T 7: 90,450,854 M160I possibly damaging Het
Tmem200b C T 4: 131,922,393 P208L probably benign Het
Tnrc6c T C 11: 117,714,126 V29A probably benign Het
Tsc1 C T 2: 28,675,732 S465F probably benign Het
Ttll5 A G 12: 85,917,673 probably null Het
Unc13d G T 11: 116,063,726 L1019I probably damaging Het
Vmn2r102 A T 17: 19,694,408 H745L probably damaging Het
Wars2 T G 3: 99,216,641 S273A probably damaging Het
Xrcc6 C A 15: 82,035,754 S498* probably null Het
Ybx1 A T 4: 119,282,853 N92K possibly damaging Het
Other mutations in Frmd4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Frmd4a APN 2 4594714 missense probably benign 0.00
IGL00508:Frmd4a APN 2 4594734 nonsense probably null
IGL01331:Frmd4a APN 2 4602225 missense probably benign 0.32
IGL01774:Frmd4a APN 2 4535236 splice site probably benign
IGL01909:Frmd4a APN 2 4604033 missense probably benign 0.11
IGL02170:Frmd4a APN 2 4566177 missense probably damaging 0.99
IGL02269:Frmd4a APN 2 4604234 missense probably benign 0.19
IGL02377:Frmd4a APN 2 4534574 missense possibly damaging 0.47
IGL03308:Frmd4a APN 2 4498026 missense possibly damaging 0.95
R0066:Frmd4a UTSW 2 4473152 missense probably damaging 1.00
R0066:Frmd4a UTSW 2 4473152 missense probably damaging 1.00
R0081:Frmd4a UTSW 2 4572441 critical splice donor site probably null
R0128:Frmd4a UTSW 2 4604092 missense probably damaging 0.98
R0130:Frmd4a UTSW 2 4604092 missense probably damaging 0.98
R0376:Frmd4a UTSW 2 4572387 missense probably damaging 0.97
R0529:Frmd4a UTSW 2 4606023 missense probably damaging 1.00
R0549:Frmd4a UTSW 2 4603967 missense possibly damaging 0.76
R1593:Frmd4a UTSW 2 4473188 missense probably damaging 1.00
R1959:Frmd4a UTSW 2 4535186 missense probably damaging 1.00
R2002:Frmd4a UTSW 2 4572365 missense probably damaging 1.00
R2100:Frmd4a UTSW 2 4606023 missense probably damaging 1.00
R2310:Frmd4a UTSW 2 4572399 frame shift probably null
R2340:Frmd4a UTSW 2 4586376 missense probably damaging 1.00
R2426:Frmd4a UTSW 2 4529862 missense probably damaging 1.00
R2680:Frmd4a UTSW 2 4534553 missense probably damaging 1.00
R3409:Frmd4a UTSW 2 4153028 intron probably benign
R3772:Frmd4a UTSW 2 4590622 missense probably damaging 0.99
R3773:Frmd4a UTSW 2 4590622 missense probably damaging 0.99
R3932:Frmd4a UTSW 2 4537260 missense probably damaging 1.00
R4094:Frmd4a UTSW 2 4611032 missense probably damaging 1.00
R4226:Frmd4a UTSW 2 4333078 missense probably benign 0.00
R4299:Frmd4a UTSW 2 4333071 missense probably benign 0.02
R4304:Frmd4a UTSW 2 4333078 missense probably benign 0.00
R4306:Frmd4a UTSW 2 4333078 missense probably benign 0.00
R4307:Frmd4a UTSW 2 4333078 missense probably benign 0.00
R4346:Frmd4a UTSW 2 4608033 missense possibly damaging 0.92
R4360:Frmd4a UTSW 2 4601241 missense probably damaging 1.00
R4384:Frmd4a UTSW 2 4594563 nonsense probably null
R4547:Frmd4a UTSW 2 4473145 missense probably damaging 1.00
R4575:Frmd4a UTSW 2 4603679 missense possibly damaging 0.83
R4577:Frmd4a UTSW 2 4603679 missense possibly damaging 0.83
R4578:Frmd4a UTSW 2 4603679 missense possibly damaging 0.83
R4688:Frmd4a UTSW 2 4537311 missense possibly damaging 0.81
R4764:Frmd4a UTSW 2 4603448 missense probably damaging 1.00
R4826:Frmd4a UTSW 2 4601297 missense probably damaging 1.00
R4879:Frmd4a UTSW 2 4529817 missense probably damaging 1.00
R5053:Frmd4a UTSW 2 4603921 missense probably damaging 1.00
R5392:Frmd4a UTSW 2 4594573 missense probably damaging 1.00
R5733:Frmd4a UTSW 2 4300957 missense possibly damaging 0.53
R5762:Frmd4a UTSW 2 4484065 missense probably damaging 1.00
R5920:Frmd4a UTSW 2 4333116 missense probably benign 0.02
R5932:Frmd4a UTSW 2 4529839 missense probably damaging 1.00
R6117:Frmd4a UTSW 2 4602249 missense possibly damaging 0.66
R6328:Frmd4a UTSW 2 4590698 missense probably damaging 0.99
R6622:Frmd4a UTSW 2 4606062 missense probably benign 0.00
R6903:Frmd4a UTSW 2 4586456 missense probably damaging 1.00
R7065:Frmd4a UTSW 2 4566112
R7258:Frmd4a UTSW 2 4300953 missense probably benign
R7336:Frmd4a UTSW 2 4473214 missense possibly damaging 0.92
R7582:Frmd4a UTSW 2 4594597 frame shift probably null
R7607:Frmd4a UTSW 2 4591936 nonsense probably null
R7697:Frmd4a UTSW 2 4484081 missense probably damaging 1.00
R7750:Frmd4a UTSW 2 4601349 missense probably benign 0.14
R7795:Frmd4a UTSW 2 4590695 missense probably damaging 1.00
R7848:Frmd4a UTSW 2 4591917 intron probably benign
R7899:Frmd4a UTSW 2 4604089 missense probably damaging 1.00
R8024:Frmd4a UTSW 2 4603702 missense probably damaging 1.00
R8399:Frmd4a UTSW 2 4572433 missense probably damaging 1.00
Z1176:Frmd4a UTSW 2 4498021 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGGATTCGGGCTTACAAG -3'
(R):5'- TGTGCCTCACTGAAGTTACACAC -3'

Sequencing Primer
(F):5'- ATTCGGGCTTACAAGTAGGC -3'
(R):5'- GAAGTTACACACATCTCCCTCTG -3'
Posted On2019-05-15