Mutagenetix > Incidental Mutation

Incidental Mutation 'R7098:Adamts3'

550629

Institutional Source

Beutler Lab

Gene Symbol

Adamts3

Ensembl Gene

ENSMUSG00000043635

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 3

Synonyms

6330442E02Rik, 1100001H14Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7098 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

89677087-89883334 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 89861495 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Aspartic acid at position 103 (A103D)

Ref Sequence

ENSEMBL: ENSMUSP00000132219 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061427] [ENSMUST00000163159] [ENSMUST00000198151]

AlphaFold

E9Q287

Predicted Effect

probably damaging
Transcript: ENSMUST00000061427
AA Change: A103D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000058552
Gene: ENSMUSG00000043635
AA Change: A103D

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Pep_M12B_propep	42	201	5.1e-40	PFAM
Pfam:Reprolysin_5	254	439	5.4e-15	PFAM
Pfam:Reprolysin_4	256	454	1.9e-10	PFAM
Pfam:Reprolysin	257	460	3.6e-22	PFAM
Pfam:Reprolysin_2	274	451	7.7e-13	PFAM
Pfam:Reprolysin_3	278	409	1.5e-12	PFAM
TSP1	554	606	1.26e-15	SMART
Pfam:ADAM_spacer1	713	827	3e-34	PFAM
TSP1	848	905	4.35e-2	SMART
TSP1	908	967	4.95e-2	SMART
TSP1	969	1016	6.58e-5	SMART
low complexity region	1114	1128	N/A	INTRINSIC
low complexity region	1157	1177	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000163159
AA Change: A103D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000132219
Gene: ENSMUSG00000043635
AA Change: A103D

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Pep_M12B_propep	43	201	1.5e-40	PFAM
Pfam:Reprolysin_5	254	439	2.2e-15	PFAM
Pfam:Reprolysin_4	256	454	7.7e-11	PFAM
Pfam:Reprolysin	257	460	3.7e-21	PFAM
Pfam:Reprolysin_2	274	451	4.3e-14	PFAM
Pfam:Reprolysin_3	278	409	1.3e-12	PFAM
TSP1	554	606	1.26e-15	SMART
Pfam:ADAM_spacer1	713	828	3.6e-28	PFAM
TSP1	849	906	4.35e-2	SMART
TSP1	909	968	4.95e-2	SMART
TSP1	970	1017	6.58e-5	SMART
low complexity region	1115	1129	N/A	INTRINSIC
low complexity region	1158	1178	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000198151
AA Change: A103D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000142771
Gene: ENSMUSG00000043635
AA Change: A103D

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Pep_M12B_propep	42	174	2.3e-29	PFAM

Meta Mutation Damage Score

0.8405

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (78/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease, a member of the procollagen aminopropeptidase subfamily of proteins, may play a role in the processing of type II fibrillar collagen in articular cartilage. [provided by RefSeq, Feb 2016]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A430033K04Rik	T	A	5: 138,646,522	M223K	probably benign	Het
Abce1	T	C	8: 79,686,049	T550A	probably benign	Het
Acoxl	C	T	2: 127,854,915	Q28*	probably null	Het
Adam8	T	C	7: 139,979,499	K820R	possibly damaging	Het
Apba2	T	A	7: 64,736,948	V441D	probably damaging	Het
Arap2	A	G	5: 62,675,950		probably null	Het
Arhgef10l	T	A	4: 140,580,911	M44L	probably benign	Het
Asb4	T	C	6: 5,398,499	C155R	probably damaging	Het
Bpifb6	A	T	2: 153,906,890	K269*	probably null	Het
Cc2d2a	A	T	5: 43,683,139	T161S	probably benign	Het
Ccdc15	T	A	9: 37,343,960	Q98L	probably damaging	Het
Col19a1	A	G	1: 24,526,474	S259P	unknown	Het
Col5a2	A	T	1: 45,380,067	D1284E	possibly damaging	Het
Cyp2c70	T	C	19: 40,180,487	T119A	probably benign	Het
Dennd6b	C	T	15: 89,188,687	C188Y	probably damaging	Het
Dhx8	T	A	11: 101,737,768		probably null	Het
Dhx9	T	C	1: 153,465,022	K624R	probably benign	Het
Dpys	C	T	15: 39,793,331	V447M	probably damaging	Het
E130308A19Rik	T	C	4: 59,753,004	S706P	possibly damaging	Het
Esrrb	A	G	12: 86,470,415	D107G	probably benign	Het
Fam71d	G	A	12: 78,719,634		probably null	Het
Frmd4a	T	C	2: 4,572,433	S367P	probably damaging	Het
Gdi1	G	A	X: 74,306,855	R55H	probably benign	Het
Gm136	T	C	4: 34,746,628	I128V	probably benign	Het
Gm6525	T	A	3: 84,175,002	C77S	possibly damaging	Het
Grid2ip	T	C	5: 143,357,591	F14S	probably damaging	Het
Hdhd3	C	T	4: 62,499,915	R8H	probably damaging	Het
Kdelr1	C	A	7: 45,874,056	A69D	possibly damaging	Het
Krtap16-3	T	A	16: 88,962,672	Y51F	unknown	Het
Lrrc40	T	A	3: 158,041,639	N129K	probably benign	Het
Man1b1	T	A	2: 25,338,184	D155E	probably damaging	Het
Mcm5	T	C	8: 75,120,901	V442A	probably damaging	Het
Mfsd14a	C	T	3: 116,641,712	A235T	probably benign	Het
Mmp1a	C	A	9: 7,475,937	T401K	probably benign	Het
Mpig6b	C	T	17: 35,064,344	R196Q	unknown	Het
Mroh1	C	T	15: 76,408,457	Q262*	probably null	Het
Msh3	A	T	13: 92,274,111	D656E	possibly damaging	Het
Muc4	A	T	16: 32,757,091	T252S		Het
Myh15	C	T	16: 49,177,057	A1746V	possibly damaging	Het
Myh8	C	A	11: 67,279,053	T66K	probably benign	Het
Nemf	A	T	12: 69,312,467	Y999N	probably damaging	Het
Neurod1	T	C	2: 79,454,685	N118S	probably damaging	Het
Nlrp1b	T	A	11: 71,218,274	I134L	possibly damaging	Het
Nsun7	A	T	5: 66,260,983	I19F	probably damaging	Het
Ofcc1	A	G	13: 40,003,966		probably null	Het
P2rx7	A	G	5: 122,673,793	E389G	probably damaging	Het
Pam	C	T	1: 97,898,347	R194H	probably benign	Het
Pcnt	A	G	10: 76,384,839	S2052P	probably benign	Het
Pfkfb4	T	A	9: 108,999,154	Y86N	probably benign	Het
Plcd3	T	A	11: 103,077,863	D334V	probably damaging	Het
Ppard	T	C	17: 28,298,813	V285A	possibly damaging	Het
Prune2	A	G	19: 17,120,602	S1157G	probably benign	Het
Psg21	A	T	7: 18,652,545	L172H	probably damaging	Het
Psme4	C	A	11: 30,850,661	T1417K	probably damaging	Het
Ptprc	T	C	1: 138,099,685	D336G	probably benign	Het
Ralgapa1	A	T	12: 55,790,310		probably null	Het
Rap1gap	C	A	4: 137,716,082		probably null	Het
Scap	T	C	9: 110,372,242	S100P	possibly damaging	Het
Scpep1	T	C	11: 88,929,185	I426V	possibly damaging	Het
Sdk1	T	C	5: 142,096,870	I1341T	probably damaging	Het
Sfmbt2	T	A	2: 10,579,189	Y786N	probably benign	Het
Sh3tc1	A	T	5: 35,702,014		probably null	Het
Slc5a5	T	A	8: 70,888,538	I386F	probably damaging	Het
Smarca4	T	G	9: 21,634,820	M98R	probably benign	Het
St18	G	A	1: 6,827,842	D623N	probably damaging	Het
Sult2a1	A	T	7: 13,816,053		probably null	Het
Tgfb2	C	T	1: 186,630,637	R330H	probably damaging	Het
Thoc3	A	G	13: 54,466,306	I168T	probably damaging	Het
Tmem126a	C	T	7: 90,450,854	M160I	possibly damaging	Het
Tmem200b	C	T	4: 131,922,393	P208L	probably benign	Het
Tnrc6c	T	C	11: 117,714,126	V29A	probably benign	Het
Tsc1	C	T	2: 28,675,732	S465F	probably benign	Het
Ttll5	A	G	12: 85,917,673		probably null	Het
Unc13d	G	T	11: 116,063,726	L1019I	probably damaging	Het
Vmn2r102	A	T	17: 19,694,408	H745L	probably damaging	Het
Wars2	T	G	3: 99,216,641	S273A	probably damaging	Het
Xrcc6	C	A	15: 82,035,754	S498*	probably null	Het
Ybx1	A	T	4: 119,282,853	N92K	possibly damaging	Het

Other mutations in Adamts3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Adamts3	APN	5	89861325	missense	probably damaging	1.00
IGL00340:Adamts3	APN	5	89701666	missense	probably damaging	1.00
IGL00923:Adamts3	APN	5	89684376	missense	probably benign	0.06
IGL01420:Adamts3	APN	5	89703057	missense	possibly damaging	0.57
IGL01522:Adamts3	APN	5	89702943	missense	probably benign	0.14
IGL01676:Adamts3	APN	5	89677754	missense	probably benign	0.00
IGL01676:Adamts3	APN	5	89881543	missense	possibly damaging	0.54
IGL01678:Adamts3	APN	5	89707856	missense	probably damaging	1.00
IGL01936:Adamts3	APN	5	89861423	missense	probably benign	0.00
IGL01956:Adamts3	APN	5	89677911	missense	probably damaging	0.99
IGL02342:Adamts3	APN	5	89691473	splice site	probably null
IGL02415:Adamts3	APN	5	89706647	splice site	probably null
IGL03261:Adamts3	APN	5	89882897	utr 5 prime	probably benign
IGL03301:Adamts3	APN	5	89707404	missense	probably damaging	1.00
R0041:Adamts3	UTSW	5	89684467	missense	probably benign
R0079:Adamts3	UTSW	5	89693053	missense	probably benign	0.00
R0096:Adamts3	UTSW	5	89701717	nonsense	probably null
R0096:Adamts3	UTSW	5	89701717	nonsense	probably null
R0477:Adamts3	UTSW	5	89684507	missense	probably benign
R0605:Adamts3	UTSW	5	89861475	missense	possibly damaging	0.96
R1036:Adamts3	UTSW	5	89696093	splice site	probably benign
R1462:Adamts3	UTSW	5	89861349	missense	probably benign	0.17
R1462:Adamts3	UTSW	5	89861349	missense	probably benign	0.17
R1621:Adamts3	UTSW	5	89721701	missense	probably damaging	1.00
R1799:Adamts3	UTSW	5	89775421	missense	probably benign	0.00
R2163:Adamts3	UTSW	5	89708718	missense	probably damaging	0.99
R2412:Adamts3	UTSW	5	89701771	missense	probably damaging	0.99
R2420:Adamts3	UTSW	5	89683175	missense	probably damaging	0.97
R2421:Adamts3	UTSW	5	89683175	missense	probably damaging	0.97
R2422:Adamts3	UTSW	5	89683175	missense	probably damaging	0.97
R2921:Adamts3	UTSW	5	89861534	missense	possibly damaging	0.90
R2922:Adamts3	UTSW	5	89861534	missense	possibly damaging	0.90
R2923:Adamts3	UTSW	5	89861534	missense	possibly damaging	0.90
R3402:Adamts3	UTSW	5	89701733	missense	probably benign	0.04
R3431:Adamts3	UTSW	5	89707453	splice site	probably benign
R3432:Adamts3	UTSW	5	89707453	splice site	probably benign
R3813:Adamts3	UTSW	5	89677926	missense	possibly damaging	0.67
R3816:Adamts3	UTSW	5	89705264	missense	probably damaging	0.99
R3905:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R3906:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R3907:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R3908:Adamts3	UTSW	5	89861355	missense	probably damaging	1.00
R4557:Adamts3	UTSW	5	89700487	missense	probably benign	0.03
R4684:Adamts3	UTSW	5	89703007	missense	probably damaging	0.98
R4844:Adamts3	UTSW	5	89677816	missense	probably damaging	0.99
R4925:Adamts3	UTSW	5	89684323	missense	probably benign	0.01
R5097:Adamts3	UTSW	5	89693050	missense	probably damaging	0.97
R5100:Adamts3	UTSW	5	89708643	missense	probably damaging	1.00
R5237:Adamts3	UTSW	5	89775377	missense	probably benign
R5265:Adamts3	UTSW	5	89861552	missense	possibly damaging	0.91
R5322:Adamts3	UTSW	5	89707300	splice site	probably null
R5413:Adamts3	UTSW	5	89708767	missense	probably damaging	1.00
R5459:Adamts3	UTSW	5	89691473	splice site	probably null
R5738:Adamts3	UTSW	5	89708668	missense	probably damaging	1.00
R5979:Adamts3	UTSW	5	89861669	missense	probably damaging	0.96
R5992:Adamts3	UTSW	5	89691335	missense	probably damaging	1.00
R6364:Adamts3	UTSW	5	89721814	missense	possibly damaging	0.92
R6572:Adamts3	UTSW	5	89861609	missense	possibly damaging	0.87
R7172:Adamts3	UTSW	5	89883001	start gained	probably benign
R7263:Adamts3	UTSW	5	89677742	missense	probably benign	0.03
R7401:Adamts3	UTSW	5	89707450	critical splice acceptor site	probably null
R7599:Adamts3	UTSW	5	89861397	missense	probably benign	0.00
R7829:Adamts3	UTSW	5	89861490	missense	probably damaging	1.00
R7835:Adamts3	UTSW	5	89700440	missense	possibly damaging	0.70
R7892:Adamts3	UTSW	5	89861429	missense	probably benign	0.10
R8021:Adamts3	UTSW	5	89683184	missense	possibly damaging	0.47
R8289:Adamts3	UTSW	5	89775423	missense	possibly damaging	0.89
R8350:Adamts3	UTSW	5	89702956	missense	probably damaging	1.00
R8468:Adamts3	UTSW	5	89694768	missense	probably benign	0.19
R8827:Adamts3	UTSW	5	89691465	missense	probably benign	0.03
R8864:Adamts3	UTSW	5	89707122	intron	probably benign
R8906:Adamts3	UTSW	5	89677716	missense	probably damaging	0.98
R9000:Adamts3	UTSW	5	89706711	missense	probably benign	0.17
R9005:Adamts3	UTSW	5	89677834	missense	probably benign	0.08
R9378:Adamts3	UTSW	5	89700410	nonsense	probably null
R9505:Adamts3	UTSW	5	89707892	missense	probably damaging	1.00
R9516:Adamts3	UTSW	5	89686891	missense	probably damaging	1.00
X0064:Adamts3	UTSW	5	89703042	missense	possibly damaging	0.75
Z1088:Adamts3	UTSW	5	89684449	missense	probably damaging	0.99
Z1176:Adamts3	UTSW	5	89775351	missense	not run
Z1177:Adamts3	UTSW	5	89707864	nonsense	probably null
Z1177:Adamts3	UTSW	5	89775351	missense	not run

Predicted Primers

PCR Primer
(F):5'- CCCTTCCATGTTCATACAGGAAAGG -3'
(R):5'- TGGTGACACCAGTTAGCACG -3'

Sequencing Primer
(F):5'- GACCATCACAGTTGCTAATGGC -3'
(R):5'- CCAGTTAGCACGAATCTAAAAGG -3'

Posted On

2019-05-15