Incidental Mutation 'R7098:Apba2'
ID550637
Institutional Source Beutler Lab
Gene Symbol Apba2
Ensembl Gene ENSMUSG00000030519
Gene Nameamyloid beta (A4) precursor protein-binding, family A, member 2
SynonymsX11L, X11-like, Mint 2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock #R7098 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location64501706-64753878 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 64736948 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 441 (V441D)
Ref Sequence ENSEMBL: ENSMUSP00000032732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032732] [ENSMUST00000206246]
Predicted Effect probably damaging
Transcript: ENSMUST00000032732
AA Change: V441D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032732
Gene: ENSMUSG00000030519
AA Change: V441D

DomainStartEndE-ValueType
low complexity region 82 96 N/A INTRINSIC
low complexity region 216 230 N/A INTRINSIC
PTB 368 534 6.31e-29 SMART
PDZ 578 656 6.32e-12 SMART
PDZ 670 736 1.79e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000206246
AA Change: V429D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.9150 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the X11 protein family. It is a neuronal adapter protein that interacts with the Alzheimer's disease amyloid precursor protein (APP). It stabilizes APP and inhibits production of proteolytic APP fragments including the A beta peptide that is deposited in the brains of Alzheimer's disease patients. This gene product is believed to be involved in signal transduction processes. It is also regarded as a putative vesicular trafficking protein in the brain that can form a complex with the potential to couple synaptic vesicle exocytosis to neuronal cell adhesion. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene show a selective deficit in motivated approach behavior, but not in motivated avoidance behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik T A 5: 138,646,522 M223K probably benign Het
Abce1 T C 8: 79,686,049 T550A probably benign Het
Acoxl C T 2: 127,854,915 Q28* probably null Het
Adam8 T C 7: 139,979,499 K820R possibly damaging Het
Adamts3 G T 5: 89,861,495 A103D probably damaging Het
Arap2 A G 5: 62,675,950 probably null Het
Arhgef10l T A 4: 140,580,911 M44L probably benign Het
Asb4 T C 6: 5,398,499 C155R probably damaging Het
Bpifb6 A T 2: 153,906,890 K269* probably null Het
Cc2d2a A T 5: 43,683,139 T161S probably benign Het
Ccdc15 T A 9: 37,343,960 Q98L probably damaging Het
Col19a1 A G 1: 24,526,474 S259P unknown Het
Col5a2 A T 1: 45,380,067 D1284E possibly damaging Het
Cyp2c70 T C 19: 40,180,487 T119A probably benign Het
Dennd6b C T 15: 89,188,687 C188Y probably damaging Het
Dhx8 T A 11: 101,737,768 probably null Het
Dhx9 T C 1: 153,465,022 K624R probably benign Het
Dpys C T 15: 39,793,331 V447M probably damaging Het
E130308A19Rik T C 4: 59,753,004 S706P possibly damaging Het
Esrrb A G 12: 86,470,415 D107G probably benign Het
Fam71d G A 12: 78,719,634 probably null Het
Frmd4a T C 2: 4,572,433 S367P probably damaging Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gm136 T C 4: 34,746,628 I128V probably benign Het
Gm6525 T A 3: 84,175,002 C77S possibly damaging Het
Grid2ip T C 5: 143,357,591 F14S probably damaging Het
Hdhd3 C T 4: 62,499,915 R8H probably damaging Het
Kdelr1 C A 7: 45,874,056 A69D possibly damaging Het
Krtap16-3 T A 16: 88,962,672 Y51F unknown Het
Lrrc40 T A 3: 158,041,639 N129K probably benign Het
Man1b1 T A 2: 25,338,184 D155E probably damaging Het
Mcm5 T C 8: 75,120,901 V442A probably damaging Het
Mfsd14a C T 3: 116,641,712 A235T probably benign Het
Mmp1a C A 9: 7,475,937 T401K probably benign Het
Mpig6b C T 17: 35,064,344 R196Q unknown Het
Mroh1 C T 15: 76,408,457 Q262* probably null Het
Msh3 A T 13: 92,274,111 D656E possibly damaging Het
Muc4 A T 16: 32,757,091 T252S Het
Myh15 C T 16: 49,177,057 A1746V possibly damaging Het
Myh8 C A 11: 67,279,053 T66K probably benign Het
Nemf A T 12: 69,312,467 Y999N probably damaging Het
Neurod1 T C 2: 79,454,685 N118S probably damaging Het
Nlrp1b T A 11: 71,218,274 I134L possibly damaging Het
Nsun7 A T 5: 66,260,983 I19F probably damaging Het
Ofcc1 A G 13: 40,003,966 probably null Het
P2rx7 A G 5: 122,673,793 E389G probably damaging Het
Pam C T 1: 97,898,347 R194H probably benign Het
Pcnt A G 10: 76,384,839 S2052P probably benign Het
Pfkfb4 T A 9: 108,999,154 Y86N probably benign Het
Plcd3 T A 11: 103,077,863 D334V probably damaging Het
Ppard T C 17: 28,298,813 V285A possibly damaging Het
Prune2 A G 19: 17,120,602 S1157G probably benign Het
Psg21 A T 7: 18,652,545 L172H probably damaging Het
Psme4 C A 11: 30,850,661 T1417K probably damaging Het
Ptprc T C 1: 138,099,685 D336G probably benign Het
Ralgapa1 A T 12: 55,790,310 probably null Het
Rap1gap C A 4: 137,716,082 probably null Het
Scap T C 9: 110,372,242 S100P possibly damaging Het
Scpep1 T C 11: 88,929,185 I426V possibly damaging Het
Sdk1 T C 5: 142,096,870 I1341T probably damaging Het
Sfmbt2 T A 2: 10,579,189 Y786N probably benign Het
Sh3tc1 A T 5: 35,702,014 probably null Het
Slc5a5 T A 8: 70,888,538 I386F probably damaging Het
Smarca4 T G 9: 21,634,820 M98R probably benign Het
St18 G A 1: 6,827,842 D623N probably damaging Het
Sult2a1 A T 7: 13,816,053 probably null Het
Tgfb2 C T 1: 186,630,637 R330H probably damaging Het
Thoc3 A G 13: 54,466,306 I168T probably damaging Het
Tmem126a C T 7: 90,450,854 M160I possibly damaging Het
Tmem200b C T 4: 131,922,393 P208L probably benign Het
Tnrc6c T C 11: 117,714,126 V29A probably benign Het
Tsc1 C T 2: 28,675,732 S465F probably benign Het
Ttll5 A G 12: 85,917,673 probably null Het
Unc13d G T 11: 116,063,726 L1019I probably damaging Het
Vmn2r102 A T 17: 19,694,408 H745L probably damaging Het
Wars2 T G 3: 99,216,641 S273A probably damaging Het
Xrcc6 C A 15: 82,035,754 S498* probably null Het
Ybx1 A T 4: 119,282,853 N92K possibly damaging Het
Other mutations in Apba2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Apba2 APN 7 64736941 missense possibly damaging 0.79
IGL01716:Apba2 APN 7 64745826 splice site probably benign
IGL02218:Apba2 APN 7 64695677 missense probably benign 0.01
IGL02343:Apba2 APN 7 64695146 missense probably damaging 0.96
IGL03265:Apba2 APN 7 64695323 missense probably damaging 1.00
guadalupe UTSW 7 64750164 missense probably damaging 1.00
LCD18:Apba2 UTSW 7 64622160 intron probably benign
R0395:Apba2 UTSW 7 64743408 missense probably benign 0.00
R0554:Apba2 UTSW 7 64745780 missense probably damaging 1.00
R0624:Apba2 UTSW 7 64714515 splice site probably null
R0733:Apba2 UTSW 7 64750164 missense probably damaging 1.00
R1107:Apba2 UTSW 7 64745719 missense possibly damaging 0.51
R1464:Apba2 UTSW 7 64695549 missense probably benign
R1464:Apba2 UTSW 7 64695549 missense probably benign
R1486:Apba2 UTSW 7 64736948 missense probably damaging 1.00
R1895:Apba2 UTSW 7 64744630 critical splice donor site probably null
R1942:Apba2 UTSW 7 64695470 missense possibly damaging 0.92
R1946:Apba2 UTSW 7 64744630 critical splice donor site probably null
R2002:Apba2 UTSW 7 64733542 missense probably damaging 0.97
R2089:Apba2 UTSW 7 64695593 missense probably benign 0.02
R2091:Apba2 UTSW 7 64695593 missense probably benign 0.02
R2091:Apba2 UTSW 7 64695593 missense probably benign 0.02
R2571:Apba2 UTSW 7 64745750 missense probably damaging 0.98
R3035:Apba2 UTSW 7 64739792 missense probably benign 0.03
R4620:Apba2 UTSW 7 64714467 missense probably damaging 1.00
R5468:Apba2 UTSW 7 64745762 missense probably damaging 1.00
R5478:Apba2 UTSW 7 64695186 nonsense probably null
R5644:Apba2 UTSW 7 64715511 missense probably benign
R5645:Apba2 UTSW 7 64695806 missense possibly damaging 0.92
R5941:Apba2 UTSW 7 64745716 missense probably benign 0.03
R5969:Apba2 UTSW 7 64744447 nonsense probably null
R6190:Apba2 UTSW 7 64739880 missense probably damaging 0.98
R6806:Apba2 UTSW 7 64695459 missense probably damaging 1.00
R7143:Apba2 UTSW 7 64744417 missense probably damaging 1.00
R7183:Apba2 UTSW 7 64733545 missense probably benign 0.11
R7260:Apba2 UTSW 7 64739745 missense probably damaging 1.00
R7479:Apba2 UTSW 7 64739859 missense possibly damaging 0.63
R7677:Apba2 UTSW 7 64695097 missense probably benign 0.02
Z1177:Apba2 UTSW 7 64750235 missense not run
Predicted Primers PCR Primer
(F):5'- CTGTGCTCTGGGCCTTTAGAAG -3'
(R):5'- TCACCCAGATTCCCTGACAG -3'

Sequencing Primer
(F):5'- AAACAGGCTTGCTGTGGC -3'
(R):5'- TTCCCTGACAGTGACAGATAAG -3'
Posted On2019-05-15