Incidental Mutation 'R0595:Ifitm1'
Institutional Source Beutler Lab
Gene Symbol Ifitm1
Ensembl Gene ENSMUSG00000025491
Gene Nameinterferon induced transmembrane protein 1
Synonyms1110036C17Rik, Mil2, fragilis2
MMRRC Submission 038785-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0595 (G1)
Quality Score217
Status Validated
Chromosomal Location140967221-140969825 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 140968329 bp
Amino Acid Change Isoleucine to Asparagine at position 25 (I25N)
Ref Sequence ENSEMBL: ENSMUSP00000101657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026564] [ENSMUST00000106040] [ENSMUST00000106042]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026564
AA Change: I25N

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000026564
Gene: ENSMUSG00000025491
AA Change: I25N

Pfam:Dispanin 18 101 1.3e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106040
AA Change: I25N

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101655
Gene: ENSMUSG00000025491
AA Change: I25N

Pfam:Dispanin 18 101 1.3e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106042
AA Change: I25N

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101657
Gene: ENSMUSG00000025491
AA Change: I25N

Pfam:CD225 24 101 2.9e-31 PFAM
Meta Mutation Damage Score 0.7162 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency 100% (50/50)
MGI Phenotype PHENOTYPE: Homozygous mutant mice exhibited enhanced motor coordination during inverted screen testing when compared with that of their wild-type littermates. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a T A 5: 8,740,417 D1093E probably damaging Het
Aldh2 G T 5: 121,573,500 A276D probably damaging Het
Aldh2 C T 5: 121,573,501 A276T probably damaging Het
Aldh7a1 C T 18: 56,546,893 probably benign Het
Ano1 C T 7: 144,590,153 R964H possibly damaging Het
Apob G A 12: 8,008,369 V2251I probably benign Het
Atp6v1e1 A G 6: 120,801,130 V148A probably benign Het
Bbs9 T A 9: 22,496,815 H73Q probably benign Het
Brca1 A G 11: 101,524,887 V807A probably benign Het
Cacna1b C T 2: 24,649,989 probably benign Het
Cadps2 A T 6: 23,321,704 probably null Het
Cep152 T C 2: 125,595,063 Q519R probably damaging Het
Cep295 A C 9: 15,332,191 Y1608* probably null Het
Cfap54 T C 10: 92,884,736 I2619V unknown Het
Dnajb9 A G 12: 44,208,284 V7A probably benign Het
Ep400 T C 5: 110,703,542 K1358R unknown Het
Fbxw7 C A 3: 84,977,367 probably null Het
Fsip2 T C 2: 82,946,952 Y108H probably damaging Het
Ggt6 T A 11: 72,437,667 L331Q probably damaging Het
Krt75 C T 15: 101,568,354 E367K probably damaging Het
Lifr A G 15: 7,177,469 Y487C probably damaging Het
Map3k6 G T 4: 133,241,263 G59W probably damaging Het
Mme A G 3: 63,328,181 T129A probably benign Het
Mmp10 G A 9: 7,508,198 E442K probably benign Het
Myh13 T C 11: 67,344,846 S646P probably benign Het
Nbea A T 3: 55,628,496 I2889N probably benign Het
Nlrp4d T A 7: 10,381,045 K581N probably benign Het
Nr3c2 C T 8: 76,909,604 P445S possibly damaging Het
Olfr487 A T 7: 108,211,661 N289K probably damaging Het
Pck1 T A 2: 173,157,029 V360E probably damaging Het
Plekha7 T C 7: 116,144,968 D766G probably damaging Het
Prag1 A G 8: 36,147,002 N1236S probably damaging Het
Prkdc A C 16: 15,808,088 Q3326P probably damaging Het
Prrc2b T C 2: 32,183,177 M57T probably damaging Het
Rb1 A T 14: 73,273,680 F330I probably damaging Het
Rufy4 A G 1: 74,140,930 E448G possibly damaging Het
Scn10a T A 9: 119,666,063 M371L probably benign Het
Sgta T C 10: 81,048,908 D189G probably damaging Het
Spata31d1b A G 13: 59,716,277 H413R probably benign Het
Stau2 T C 1: 16,440,450 T95A probably damaging Het
Supt4a C T 11: 87,743,156 probably null Het
Tanc2 A G 11: 105,714,177 probably null Het
Tap2 T A 17: 34,212,354 V422D probably damaging Het
Tas2r138 A G 6: 40,612,865 L149P probably damaging Het
Tex15 T C 8: 33,572,617 S692P probably damaging Het
Tgm2 C T 2: 158,143,042 R48H probably damaging Het
Ticrr T A 7: 79,695,563 F1725L possibly damaging Het
Tnpo2 T A 8: 85,052,041 C672* probably null Het
Xkr9 A G 1: 13,700,784 I175V probably benign Het
Zfp428 T A 7: 24,515,378 S140T probably benign Het
Other mutations in Ifitm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Ifitm1 APN 7 140969624 makesense probably null
IGL00931:Ifitm1 APN 7 140968256 start codon destroyed probably damaging 1.00
IGL02048:Ifitm1 APN 7 140968292 missense probably benign
IGL02822:Ifitm1 APN 7 140968278 missense possibly damaging 0.80
R0332:Ifitm1 UTSW 7 140968453 splice site probably benign
R0445:Ifitm1 UTSW 7 140968441 splice site probably null
R0655:Ifitm1 UTSW 7 140969536 missense probably benign 0.01
R1344:Ifitm1 UTSW 7 140968350 missense probably benign 0.02
R2092:Ifitm1 UTSW 7 140969514 missense probably damaging 1.00
R2411:Ifitm1 UTSW 7 140969798 splice site probably null
R6481:Ifitm1 UTSW 7 140969606 missense probably benign 0.00
R7805:Ifitm1 UTSW 7 140968369 nonsense probably null
Z1176:Ifitm1 UTSW 7 140969517 missense probably benign 0.01
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- acacatacacacaaacatacacatac -3'
Posted On2013-07-11