Mutagenetix > Incidental Mutation

Incidental Mutation 'R7098:Psme4'

550649

Institutional Source

Beutler Lab

Gene Symbol

Psme4

Ensembl Gene

ENSMUSG00000040850

Gene Name

proteasome (prosome, macropain) activator subunit 4

Synonyms

MMRRC Submission

Accession Numbers

Genbank: NM_134013

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7098 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

30771726-30880361 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 30850661 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 1417 (T1417K)

Ref Sequence

ENSEMBL: ENSMUSP00000045460 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041231] [ENSMUST00000129824]

AlphaFold

Q5SSW2

Predicted Effect

probably damaging
Transcript: ENSMUST00000041231
AA Change: T1417K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850
AA Change: T1417K

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	122	133	N/A	INTRINSIC
Pfam:BLM10_mid	330	828	8.8e-119	PFAM
SCOP:d1b3ua_	1183	1716	3e-14	SMART
Pfam:DUF3437	1756	1843	5.3e-39	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000129824

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (78/78)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A430033K04Rik	T	A	5: 138,646,522	M223K	probably benign	Het
Abce1	T	C	8: 79,686,049	T550A	probably benign	Het
Acoxl	C	T	2: 127,854,915	Q28*	probably null	Het
Adam8	T	C	7: 139,979,499	K820R	possibly damaging	Het
Adamts3	G	T	5: 89,861,495	A103D	probably damaging	Het
Apba2	T	A	7: 64,736,948	V441D	probably damaging	Het
Arap2	A	G	5: 62,675,950		probably null	Het
Arhgef10l	T	A	4: 140,580,911	M44L	probably benign	Het
Asb4	T	C	6: 5,398,499	C155R	probably damaging	Het
Bpifb6	A	T	2: 153,906,890	K269*	probably null	Het
Cc2d2a	A	T	5: 43,683,139	T161S	probably benign	Het
Ccdc15	T	A	9: 37,343,960	Q98L	probably damaging	Het
Col19a1	A	G	1: 24,526,474	S259P	unknown	Het
Col5a2	A	T	1: 45,380,067	D1284E	possibly damaging	Het
Cyp2c70	T	C	19: 40,180,487	T119A	probably benign	Het
Dennd6b	C	T	15: 89,188,687	C188Y	probably damaging	Het
Dhx8	T	A	11: 101,737,768		probably null	Het
Dhx9	T	C	1: 153,465,022	K624R	probably benign	Het
Dpys	C	T	15: 39,793,331	V447M	probably damaging	Het
E130308A19Rik	T	C	4: 59,753,004	S706P	possibly damaging	Het
Esrrb	A	G	12: 86,470,415	D107G	probably benign	Het
Fam71d	G	A	12: 78,719,634		probably null	Het
Frmd4a	T	C	2: 4,572,433	S367P	probably damaging	Het
Gdi1	G	A	X: 74,306,855	R55H	probably benign	Het
Gm136	T	C	4: 34,746,628	I128V	probably benign	Het
Gm6525	T	A	3: 84,175,002	C77S	possibly damaging	Het
Grid2ip	T	C	5: 143,357,591	F14S	probably damaging	Het
Hdhd3	C	T	4: 62,499,915	R8H	probably damaging	Het
Kdelr1	C	A	7: 45,874,056	A69D	possibly damaging	Het
Krtap16-3	T	A	16: 88,962,672	Y51F	unknown	Het
Lrrc40	T	A	3: 158,041,639	N129K	probably benign	Het
Man1b1	T	A	2: 25,338,184	D155E	probably damaging	Het
Mcm5	T	C	8: 75,120,901	V442A	probably damaging	Het
Mfsd14a	C	T	3: 116,641,712	A235T	probably benign	Het
Mmp1a	C	A	9: 7,475,937	T401K	probably benign	Het
Mpig6b	C	T	17: 35,064,344	R196Q	unknown	Het
Mroh1	C	T	15: 76,408,457	Q262*	probably null	Het
Msh3	A	T	13: 92,274,111	D656E	possibly damaging	Het
Muc4	A	T	16: 32,757,091	T252S		Het
Myh15	C	T	16: 49,177,057	A1746V	possibly damaging	Het
Myh8	C	A	11: 67,279,053	T66K	probably benign	Het
Nemf	A	T	12: 69,312,467	Y999N	probably damaging	Het
Neurod1	T	C	2: 79,454,685	N118S	probably damaging	Het
Nlrp1b	T	A	11: 71,218,274	I134L	possibly damaging	Het
Nsun7	A	T	5: 66,260,983	I19F	probably damaging	Het
Ofcc1	A	G	13: 40,003,966		probably null	Het
P2rx7	A	G	5: 122,673,793	E389G	probably damaging	Het
Pam	C	T	1: 97,898,347	R194H	probably benign	Het
Pcnt	A	G	10: 76,384,839	S2052P	probably benign	Het
Pfkfb4	T	A	9: 108,999,154	Y86N	probably benign	Het
Plcd3	T	A	11: 103,077,863	D334V	probably damaging	Het
Ppard	T	C	17: 28,298,813	V285A	possibly damaging	Het
Prune2	A	G	19: 17,120,602	S1157G	probably benign	Het
Psg21	A	T	7: 18,652,545	L172H	probably damaging	Het
Ptprc	T	C	1: 138,099,685	D336G	probably benign	Het
Ralgapa1	A	T	12: 55,790,310		probably null	Het
Rap1gap	C	A	4: 137,716,082		probably null	Het
Scap	T	C	9: 110,372,242	S100P	possibly damaging	Het
Scpep1	T	C	11: 88,929,185	I426V	possibly damaging	Het
Sdk1	T	C	5: 142,096,870	I1341T	probably damaging	Het
Sfmbt2	T	A	2: 10,579,189	Y786N	probably benign	Het
Sh3tc1	A	T	5: 35,702,014		probably null	Het
Slc5a5	T	A	8: 70,888,538	I386F	probably damaging	Het
Smarca4	T	G	9: 21,634,820	M98R	probably benign	Het
St18	G	A	1: 6,827,842	D623N	probably damaging	Het
Sult2a1	A	T	7: 13,816,053		probably null	Het
Tgfb2	C	T	1: 186,630,637	R330H	probably damaging	Het
Thoc3	A	G	13: 54,466,306	I168T	probably damaging	Het
Tmem126a	C	T	7: 90,450,854	M160I	possibly damaging	Het
Tmem200b	C	T	4: 131,922,393	P208L	probably benign	Het
Tnrc6c	T	C	11: 117,714,126	V29A	probably benign	Het
Tsc1	C	T	2: 28,675,732	S465F	probably benign	Het
Ttll5	A	G	12: 85,917,673		probably null	Het
Unc13d	G	T	11: 116,063,726	L1019I	probably damaging	Het
Vmn2r102	A	T	17: 19,694,408	H745L	probably damaging	Het
Wars2	T	G	3: 99,216,641	S273A	probably damaging	Het
Xrcc6	C	A	15: 82,035,754	S498*	probably null	Het
Ybx1	A	T	4: 119,282,853	N92K	possibly damaging	Het

Other mutations in Psme4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Psme4	APN	11	30815710	critical splice donor site	probably null
IGL00401:Psme4	APN	11	30821079	splice site	probably benign
IGL00475:Psme4	APN	11	30845252	missense	probably benign	0.14
IGL00576:Psme4	APN	11	30823145	missense	possibly damaging	0.50
IGL00817:Psme4	APN	11	30820129	missense	probably benign	0.01
IGL01525:Psme4	APN	11	30809936	splice site	probably benign
IGL01862:Psme4	APN	11	30812038	nonsense	probably null
IGL02310:Psme4	APN	11	30837484	missense	probably benign	0.06
IGL02477:Psme4	APN	11	30842083	missense	probably damaging	0.99
IGL02545:Psme4	APN	11	30841586	missense	possibly damaging	0.81
IGL02608:Psme4	APN	11	30820944	missense	probably benign	0.34
IGL02621:Psme4	APN	11	30848131	missense	probably benign
IGL02822:Psme4	APN	11	30848204	unclassified	probably benign
IGL02833:Psme4	APN	11	30850715	unclassified	probably benign
IGL02964:Psme4	APN	11	30791095	nonsense	probably null
IGL03273:Psme4	APN	11	30848130	missense	probably damaging	1.00
IGL03348:Psme4	APN	11	30876796	missense	probably damaging	1.00
IGL03382:Psme4	APN	11	30807788	missense	possibly damaging	0.94
H2330:Psme4	UTSW	11	30851210	missense	probably benign	0.17
PIT4378001:Psme4	UTSW	11	30821079	splice site	probably benign
R0276:Psme4	UTSW	11	30811980	missense	probably damaging	1.00
R0462:Psme4	UTSW	11	30848117	missense	probably damaging	1.00
R0685:Psme4	UTSW	11	30878415	missense	probably damaging	1.00
R0766:Psme4	UTSW	11	30807687	splice site	probably null
R0830:Psme4	UTSW	11	30807797	missense	possibly damaging	0.53
R0940:Psme4	UTSW	11	30815264	missense	possibly damaging	0.53
R1018:Psme4	UTSW	11	30804310	missense	probably damaging	1.00
R1312:Psme4	UTSW	11	30807687	splice site	probably null
R1448:Psme4	UTSW	11	30852744	missense	probably damaging	1.00
R1713:Psme4	UTSW	11	30806310	missense	probably damaging	1.00
R1732:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R1813:Psme4	UTSW	11	30804353	missense	probably benign	0.14
R1905:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1907:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1911:Psme4	UTSW	11	30815658	missense	probably benign	0.02
R1956:Psme4	UTSW	11	30832424	missense	probably damaging	0.99
R1974:Psme4	UTSW	11	30819011	missense	probably benign	0.00
R1980:Psme4	UTSW	11	30832615	missense	possibly damaging	0.84
R1986:Psme4	UTSW	11	30830352	missense	probably benign	0.01
R2046:Psme4	UTSW	11	30817723	splice site	probably benign
R2142:Psme4	UTSW	11	30820998	missense	possibly damaging	0.89
R2698:Psme4	UTSW	11	30874282	critical splice donor site	probably null
R2844:Psme4	UTSW	11	30845173	splice site	probably benign
R3807:Psme4	UTSW	11	30856027	splice site	probably null
R3876:Psme4	UTSW	11	30856068	missense	probably damaging	0.99
R4420:Psme4	UTSW	11	30812028	missense	possibly damaging	0.67
R4584:Psme4	UTSW	11	30834318	missense	probably damaging	1.00
R4615:Psme4	UTSW	11	30834287	missense	probably benign	0.02
R4714:Psme4	UTSW	11	30832573	missense	probably benign	0.02
R5008:Psme4	UTSW	11	30856896	intron	probably benign
R5109:Psme4	UTSW	11	30791095	nonsense	probably null
R5155:Psme4	UTSW	11	30876806	missense	probably damaging	1.00
R5199:Psme4	UTSW	11	30853272	missense	probably benign	0.00
R5205:Psme4	UTSW	11	30832666	intron	probably benign
R5452:Psme4	UTSW	11	30791168	missense	probably benign
R5491:Psme4	UTSW	11	30815246	missense	possibly damaging	0.63
R5685:Psme4	UTSW	11	30809837	missense	probably damaging	0.99
R5764:Psme4	UTSW	11	30772364	intron	probably benign
R5853:Psme4	UTSW	11	30791234	critical splice donor site	probably null
R5865:Psme4	UTSW	11	30791993	missense	possibly damaging	0.95
R5903:Psme4	UTSW	11	30841589	missense	probably benign	0.28
R5927:Psme4	UTSW	11	30804294	missense	possibly damaging	0.82
R6004:Psme4	UTSW	11	30856896	intron	probably benign
R6102:Psme4	UTSW	11	30865567	missense	probably damaging	1.00
R6247:Psme4	UTSW	11	30853245	missense	possibly damaging	0.60
R6527:Psme4	UTSW	11	30832175	missense	probably benign
R6750:Psme4	UTSW	11	30853203	missense	probably damaging	1.00
R6885:Psme4	UTSW	11	30834307	nonsense	probably null
R6939:Psme4	UTSW	11	30837291	missense	probably damaging	0.99
R6945:Psme4	UTSW	11	30837437	missense	probably benign	0.06
R7029:Psme4	UTSW	11	30772474	intron	probably benign
R7049:Psme4	UTSW	11	30813904	splice site	probably null
R7107:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R7223:Psme4	UTSW	11	30874226	missense	probably benign	0.33
R7319:Psme4	UTSW	11	30807790	missense	probably benign	0.00
R7375:Psme4	UTSW	11	30772700	splice site	probably null
R7410:Psme4	UTSW	11	30815279	nonsense	probably null
R7469:Psme4	UTSW	11	30802837	missense	probably benign	0.20
R7651:Psme4	UTSW	11	30837334	missense	probably damaging	0.98
R7679:Psme4	UTSW	11	30878425	missense	probably damaging	0.99
R7681:Psme4	UTSW	11	30791975	missense	possibly damaging	0.63
R7822:Psme4	UTSW	11	30874245	missense	probably benign
R8013:Psme4	UTSW	11	30804320	missense	probably benign	0.06
R8130:Psme4	UTSW	11	30842026	missense	probably damaging	1.00
R8323:Psme4	UTSW	11	30843532	missense	probably damaging	0.99
R8330:Psme4	UTSW	11	30843583	missense	probably benign	0.00
R8363:Psme4	UTSW	11	30812139	missense	probably damaging	1.00
R8491:Psme4	UTSW	11	30772161	missense	possibly damaging	0.90
R8690:Psme4	UTSW	11	30837319	missense	probably benign	0.00
R8696:Psme4	UTSW	11	30809896	missense	probably damaging	0.99
R8743:Psme4	UTSW	11	30878467	missense	probably damaging	1.00
R8998:Psme4	UTSW	11	30838957	missense	possibly damaging	0.78
R9241:Psme4	UTSW	11	30865576	missense	probably damaging	1.00
R9657:Psme4	UTSW	11	30838980	missense	probably benign	0.00
R9736:Psme4	UTSW	11	30847411	missense	probably damaging	0.99
R9744:Psme4	UTSW	11	30815294	critical splice donor site	probably null
R9746:Psme4	UTSW	11	30876868	nonsense	probably null
V5088:Psme4	UTSW	11	30851210	missense	probably benign	0.17
X0063:Psme4	UTSW	11	30832600	missense	possibly damaging	0.66
Z1176:Psme4	UTSW	11	30843522	missense	possibly damaging	0.87
Z1177:Psme4	UTSW	11	30806311	missense	probably damaging	1.00
Z1177:Psme4	UTSW	11	30812138	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCATGGTAAGATCCCTCACTTG -3'
(R):5'- CCCAAATTTTCCGAATGAGAAGCAG -3'

Sequencing Primer
(F):5'- CCCTCACTTGGGTGGTCTG -3'
(R):5'- TTACACTCAAAGGCTGTCAGG -3'

Posted On

2019-05-15