Incidental Mutation 'R7098:Myh8'
ID 550650
Institutional Source Beutler Lab
Gene Symbol Myh8
Ensembl Gene ENSMUSG00000055775
Gene Name myosin, heavy polypeptide 8, skeletal muscle, perinatal
Synonyms Myhsp, MyHC-pn, Myhs-p, 4832426G23Rik
MMRRC Submission 045190-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.825) question?
Stock # R7098 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 67167950-67199460 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 67169879 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 66 (T66K)
Ref Sequence ENSEMBL: ENSMUSP00000019625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019625] [ENSMUST00000108685]
AlphaFold P13542
Predicted Effect probably benign
Transcript: ENSMUST00000019625
AA Change: T66K

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000019625
Gene: ENSMUSG00000055775
AA Change: T66K

DomainStartEndE-ValueType
Pfam:Myosin_N 37 76 2.1e-13 PFAM
MYSc 82 782 N/A SMART
IQ 783 805 5.44e-3 SMART
Pfam:Myosin_tail_1 846 1927 2.4e-164 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108685
AA Change: T66K

PolyPhen 2 Score 0.424 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000104325
Gene: ENSMUSG00000055775
AA Change: T66K

DomainStartEndE-ValueType
Pfam:Myosin_N 37 78 3.8e-17 PFAM
Pfam:Myosin_head 90 172 1.7e-31 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: This gene encodes a myosin heavy chain. The encoded protein forms a hexamer with two heavy chains, two alkali light chains, and two regulatory light chain components. This complex functions in muscle contraction. This gene is located in a cluster of related genes on chromosome 11. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik T A 5: 138,644,784 (GRCm39) M223K probably benign Het
Abce1 T C 8: 80,412,678 (GRCm39) T550A probably benign Het
Acoxl C T 2: 127,696,835 (GRCm39) Q28* probably null Het
Adam8 T C 7: 139,559,412 (GRCm39) K820R possibly damaging Het
Adamts3 G T 5: 90,009,354 (GRCm39) A103D probably damaging Het
Apba2 T A 7: 64,386,696 (GRCm39) V441D probably damaging Het
Arap2 A G 5: 62,833,293 (GRCm39) probably null Het
Arhgef10l T A 4: 140,308,222 (GRCm39) M44L probably benign Het
Asb4 T C 6: 5,398,499 (GRCm39) C155R probably damaging Het
Bpifb6 A T 2: 153,748,810 (GRCm39) K269* probably null Het
Cc2d2a A T 5: 43,840,481 (GRCm39) T161S probably benign Het
Ccdc15 T A 9: 37,255,256 (GRCm39) Q98L probably damaging Het
Col19a1 A G 1: 24,565,555 (GRCm39) S259P unknown Het
Col5a2 A T 1: 45,419,227 (GRCm39) D1284E possibly damaging Het
Cyp2c70 T C 19: 40,168,931 (GRCm39) T119A probably benign Het
Dennd6b C T 15: 89,072,890 (GRCm39) C188Y probably damaging Het
Dhx8 T A 11: 101,628,594 (GRCm39) probably null Het
Dhx9 T C 1: 153,340,768 (GRCm39) K624R probably benign Het
Dpys C T 15: 39,656,727 (GRCm39) V447M probably damaging Het
E130308A19Rik T C 4: 59,753,004 (GRCm39) S706P possibly damaging Het
Esrrb A G 12: 86,517,189 (GRCm39) D107G probably benign Het
Frmd4a T C 2: 4,577,244 (GRCm39) S367P probably damaging Het
Garin2 G A 12: 78,766,408 (GRCm39) probably null Het
Gdi1 G A X: 73,350,461 (GRCm39) R55H probably benign Het
Gm136 T C 4: 34,746,628 (GRCm39) I128V probably benign Het
Gm6525 T A 3: 84,082,309 (GRCm39) C77S possibly damaging Het
Grid2ip T C 5: 143,343,346 (GRCm39) F14S probably damaging Het
Hdhd3 C T 4: 62,418,152 (GRCm39) R8H probably damaging Het
Kdelr1 C A 7: 45,523,480 (GRCm39) A69D possibly damaging Het
Krtap16-3 T A 16: 88,759,560 (GRCm39) Y51F unknown Het
Lrrc40 T A 3: 157,747,276 (GRCm39) N129K probably benign Het
Man1b1 T A 2: 25,228,196 (GRCm39) D155E probably damaging Het
Mcm5 T C 8: 75,847,529 (GRCm39) V442A probably damaging Het
Mfsd14a C T 3: 116,435,361 (GRCm39) A235T probably benign Het
Mmp1a C A 9: 7,475,938 (GRCm39) T401K probably benign Het
Mpig6b C T 17: 35,283,320 (GRCm39) R196Q unknown Het
Mroh1 C T 15: 76,292,657 (GRCm39) Q262* probably null Het
Msh3 A T 13: 92,410,619 (GRCm39) D656E possibly damaging Het
Muc4 A T 16: 32,577,465 (GRCm39) T252S Het
Myh15 C T 16: 48,997,420 (GRCm39) A1746V possibly damaging Het
Nemf A T 12: 69,359,241 (GRCm39) Y999N probably damaging Het
Neurod1 T C 2: 79,285,029 (GRCm39) N118S probably damaging Het
Nlrp1b T A 11: 71,109,100 (GRCm39) I134L possibly damaging Het
Nsun7 A T 5: 66,418,326 (GRCm39) I19F probably damaging Het
Ofcc1 A G 13: 40,157,442 (GRCm39) probably null Het
P2rx7 A G 5: 122,811,856 (GRCm39) E389G probably damaging Het
Pam C T 1: 97,826,072 (GRCm39) R194H probably benign Het
Pcnt A G 10: 76,220,673 (GRCm39) S2052P probably benign Het
Pfkfb4 T A 9: 108,828,222 (GRCm39) Y86N probably benign Het
Plcd3 T A 11: 102,968,689 (GRCm39) D334V probably damaging Het
Ppard T C 17: 28,517,787 (GRCm39) V285A possibly damaging Het
Prune2 A G 19: 17,097,966 (GRCm39) S1157G probably benign Het
Psg21 A T 7: 18,386,470 (GRCm39) L172H probably damaging Het
Psme4 C A 11: 30,800,661 (GRCm39) T1417K probably damaging Het
Ptprc T C 1: 138,027,423 (GRCm39) D336G probably benign Het
Ralgapa1 A T 12: 55,837,095 (GRCm39) probably null Het
Rap1gap C A 4: 137,443,393 (GRCm39) probably null Het
Scap T C 9: 110,201,310 (GRCm39) S100P possibly damaging Het
Scpep1 T C 11: 88,820,011 (GRCm39) I426V possibly damaging Het
Sdk1 T C 5: 142,082,625 (GRCm39) I1341T probably damaging Het
Sfmbt2 T A 2: 10,584,000 (GRCm39) Y786N probably benign Het
Sh3tc1 A T 5: 35,859,358 (GRCm39) probably null Het
Slc5a5 T A 8: 71,341,182 (GRCm39) I386F probably damaging Het
Smarca4 T G 9: 21,546,116 (GRCm39) M98R probably benign Het
St18 G A 1: 6,898,066 (GRCm39) D623N probably damaging Het
Sult2a1 A T 7: 13,549,978 (GRCm39) probably null Het
Tgfb2 C T 1: 186,362,834 (GRCm39) R330H probably damaging Het
Thoc3 A G 13: 54,614,119 (GRCm39) I168T probably damaging Het
Tmem126a C T 7: 90,100,062 (GRCm39) M160I possibly damaging Het
Tmem200b C T 4: 131,649,704 (GRCm39) P208L probably benign Het
Tnrc6c T C 11: 117,604,952 (GRCm39) V29A probably benign Het
Tsc1 C T 2: 28,565,744 (GRCm39) S465F probably benign Het
Ttll5 A G 12: 85,964,447 (GRCm39) probably null Het
Unc13d G T 11: 115,954,552 (GRCm39) L1019I probably damaging Het
Vmn2r102 A T 17: 19,914,670 (GRCm39) H745L probably damaging Het
Wars2 T G 3: 99,123,957 (GRCm39) S273A probably damaging Het
Xrcc6 C A 15: 81,919,955 (GRCm39) S498* probably null Het
Ybx1 A T 4: 119,140,050 (GRCm39) N92K possibly damaging Het
Other mutations in Myh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Myh8 APN 11 67,174,644 (GRCm39) missense probably damaging 0.97
IGL01020:Myh8 APN 11 67,174,229 (GRCm39) missense probably damaging 0.99
IGL01348:Myh8 APN 11 67,188,606 (GRCm39) missense probably damaging 1.00
IGL01382:Myh8 APN 11 67,192,799 (GRCm39) missense probably damaging 1.00
IGL01454:Myh8 APN 11 67,174,422 (GRCm39) missense probably damaging 1.00
IGL01457:Myh8 APN 11 67,183,505 (GRCm39) missense probably benign 0.00
IGL01472:Myh8 APN 11 67,179,205 (GRCm39) splice site probably benign
IGL01473:Myh8 APN 11 67,192,651 (GRCm39) critical splice donor site probably null
IGL01613:Myh8 APN 11 67,192,536 (GRCm39) missense probably benign 0.11
IGL01763:Myh8 APN 11 67,177,245 (GRCm39) missense probably benign 0.01
IGL01828:Myh8 APN 11 67,194,652 (GRCm39) missense possibly damaging 0.82
IGL01862:Myh8 APN 11 67,180,520 (GRCm39) nonsense probably null
IGL01905:Myh8 APN 11 67,175,477 (GRCm39) missense possibly damaging 0.90
IGL02280:Myh8 APN 11 67,174,198 (GRCm39) unclassified probably benign
IGL02386:Myh8 APN 11 67,185,266 (GRCm39) missense probably damaging 0.99
IGL02449:Myh8 APN 11 67,185,440 (GRCm39) critical splice donor site probably null
IGL02500:Myh8 APN 11 67,196,536 (GRCm39) missense probably benign 0.00
IGL02745:Myh8 APN 11 67,188,327 (GRCm39) missense possibly damaging 0.88
IGL02799:Myh8 APN 11 67,192,418 (GRCm39) splice site probably benign
IGL03063:Myh8 APN 11 67,179,031 (GRCm39) missense probably benign 0.00
IGL03223:Myh8 APN 11 67,174,644 (GRCm39) missense probably damaging 0.97
IGL03336:Myh8 APN 11 67,175,528 (GRCm39) missense probably damaging 1.00
IGL03338:Myh8 APN 11 67,189,172 (GRCm39) missense probably damaging 1.00
IGL03351:Myh8 APN 11 67,194,739 (GRCm39) missense possibly damaging 0.94
IGL03392:Myh8 APN 11 67,185,244 (GRCm39) missense probably damaging 1.00
BB003:Myh8 UTSW 11 67,169,732 (GRCm39) missense possibly damaging 0.94
BB009:Myh8 UTSW 11 67,185,430 (GRCm39) missense probably benign 0.00
BB013:Myh8 UTSW 11 67,169,732 (GRCm39) missense possibly damaging 0.94
BB019:Myh8 UTSW 11 67,185,430 (GRCm39) missense probably benign 0.00
PIT4354001:Myh8 UTSW 11 67,180,456 (GRCm39) missense probably benign 0.01
R0012:Myh8 UTSW 11 67,190,847 (GRCm39) missense probably benign 0.02
R0016:Myh8 UTSW 11 67,189,351 (GRCm39) missense probably damaging 1.00
R0016:Myh8 UTSW 11 67,189,351 (GRCm39) missense probably damaging 1.00
R0115:Myh8 UTSW 11 67,197,090 (GRCm39) splice site probably benign
R0131:Myh8 UTSW 11 67,183,014 (GRCm39) missense probably damaging 0.96
R0131:Myh8 UTSW 11 67,183,014 (GRCm39) missense probably damaging 0.96
R0132:Myh8 UTSW 11 67,183,014 (GRCm39) missense probably damaging 0.96
R0238:Myh8 UTSW 11 67,192,518 (GRCm39) missense probably benign 0.00
R0238:Myh8 UTSW 11 67,192,518 (GRCm39) missense probably benign 0.00
R0239:Myh8 UTSW 11 67,192,518 (GRCm39) missense probably benign 0.00
R0239:Myh8 UTSW 11 67,192,518 (GRCm39) missense probably benign 0.00
R0393:Myh8 UTSW 11 67,196,843 (GRCm39) splice site probably benign
R0453:Myh8 UTSW 11 67,183,731 (GRCm39) missense probably benign 0.03
R0454:Myh8 UTSW 11 67,194,591 (GRCm39) nonsense probably null
R0466:Myh8 UTSW 11 67,189,405 (GRCm39) missense probably benign 0.01
R0487:Myh8 UTSW 11 67,192,837 (GRCm39) missense probably benign
R0511:Myh8 UTSW 11 67,175,333 (GRCm39) missense probably benign 0.01
R0557:Myh8 UTSW 11 67,192,624 (GRCm39) missense possibly damaging 0.88
R0589:Myh8 UTSW 11 67,189,453 (GRCm39) missense probably benign 0.00
R0658:Myh8 UTSW 11 67,175,358 (GRCm39) critical splice donor site probably null
R0782:Myh8 UTSW 11 67,180,580 (GRCm39) missense probably benign 0.16
R0829:Myh8 UTSW 11 67,174,326 (GRCm39) unclassified probably benign
R0845:Myh8 UTSW 11 67,177,090 (GRCm39) missense probably damaging 1.00
R0930:Myh8 UTSW 11 67,196,824 (GRCm39) missense possibly damaging 0.93
R0972:Myh8 UTSW 11 67,188,585 (GRCm39) missense probably damaging 1.00
R1132:Myh8 UTSW 11 67,187,957 (GRCm39) nonsense probably null
R1417:Myh8 UTSW 11 67,197,011 (GRCm39) missense probably damaging 1.00
R1478:Myh8 UTSW 11 67,183,551 (GRCm39) missense probably benign 0.23
R1497:Myh8 UTSW 11 67,180,638 (GRCm39) missense probably benign 0.00
R1605:Myh8 UTSW 11 67,192,497 (GRCm39) missense probably damaging 0.99
R1701:Myh8 UTSW 11 67,170,964 (GRCm39) missense probably damaging 1.00
R1950:Myh8 UTSW 11 67,169,830 (GRCm39) missense possibly damaging 0.75
R1989:Myh8 UTSW 11 67,183,550 (GRCm39) missense probably benign 0.00
R2010:Myh8 UTSW 11 67,187,990 (GRCm39) nonsense probably null
R2095:Myh8 UTSW 11 67,177,050 (GRCm39) missense probably benign 0.00
R2132:Myh8 UTSW 11 67,183,702 (GRCm39) missense probably damaging 1.00
R2152:Myh8 UTSW 11 67,185,295 (GRCm39) missense probably damaging 0.97
R2229:Myh8 UTSW 11 67,199,174 (GRCm39) missense probably damaging 0.98
R2302:Myh8 UTSW 11 67,177,065 (GRCm39) missense probably damaging 1.00
R2364:Myh8 UTSW 11 67,185,344 (GRCm39) missense probably benign 0.03
R2429:Myh8 UTSW 11 67,194,723 (GRCm39) missense probably benign 0.21
R2880:Myh8 UTSW 11 67,188,090 (GRCm39) missense probably damaging 0.97
R3692:Myh8 UTSW 11 67,192,744 (GRCm39) missense probably damaging 0.98
R3756:Myh8 UTSW 11 67,175,443 (GRCm39) unclassified probably benign
R3924:Myh8 UTSW 11 67,187,963 (GRCm39) missense probably damaging 0.99
R4172:Myh8 UTSW 11 67,183,247 (GRCm39) missense probably damaging 1.00
R4255:Myh8 UTSW 11 67,190,560 (GRCm39) missense probably benign
R4621:Myh8 UTSW 11 67,177,084 (GRCm39) missense probably damaging 1.00
R4623:Myh8 UTSW 11 67,177,084 (GRCm39) missense probably damaging 1.00
R4790:Myh8 UTSW 11 67,170,789 (GRCm39) missense probably damaging 0.99
R4914:Myh8 UTSW 11 67,183,510 (GRCm39) missense probably damaging 1.00
R5074:Myh8 UTSW 11 67,196,742 (GRCm39) missense possibly damaging 0.79
R5119:Myh8 UTSW 11 67,189,184 (GRCm39) missense probably damaging 1.00
R5159:Myh8 UTSW 11 67,179,179 (GRCm39) missense probably damaging 0.99
R5229:Myh8 UTSW 11 67,175,310 (GRCm39) missense probably damaging 0.96
R5320:Myh8 UTSW 11 67,177,089 (GRCm39) missense probably damaging 1.00
R5455:Myh8 UTSW 11 67,192,244 (GRCm39) missense possibly damaging 0.59
R5523:Myh8 UTSW 11 67,196,788 (GRCm39) missense possibly damaging 0.95
R5540:Myh8 UTSW 11 67,177,266 (GRCm39) missense probably benign 0.00
R5726:Myh8 UTSW 11 67,185,392 (GRCm39) missense possibly damaging 0.79
R5770:Myh8 UTSW 11 67,188,026 (GRCm39) missense probably damaging 1.00
R6135:Myh8 UTSW 11 67,188,326 (GRCm39) missense possibly damaging 0.51
R6253:Myh8 UTSW 11 67,192,793 (GRCm39) missense probably benign 0.06
R6318:Myh8 UTSW 11 67,190,167 (GRCm39) missense probably benign 0.00
R6432:Myh8 UTSW 11 67,189,405 (GRCm39) missense probably benign 0.01
R6452:Myh8 UTSW 11 67,196,565 (GRCm39) missense possibly damaging 0.88
R6452:Myh8 UTSW 11 67,183,275 (GRCm39) missense probably benign 0.27
R6512:Myh8 UTSW 11 67,180,488 (GRCm39) nonsense probably null
R6714:Myh8 UTSW 11 67,197,775 (GRCm39) missense probably damaging 1.00
R6842:Myh8 UTSW 11 67,175,481 (GRCm39) missense probably damaging 1.00
R7007:Myh8 UTSW 11 67,179,142 (GRCm39) missense probably benign 0.03
R7025:Myh8 UTSW 11 67,188,365 (GRCm39) missense probably benign 0.02
R7086:Myh8 UTSW 11 67,183,453 (GRCm39) splice site probably null
R7498:Myh8 UTSW 11 67,174,263 (GRCm39) missense possibly damaging 0.80
R7716:Myh8 UTSW 11 67,189,478 (GRCm39) missense possibly damaging 0.51
R7765:Myh8 UTSW 11 67,194,481 (GRCm39) missense probably benign 0.44
R7825:Myh8 UTSW 11 67,194,538 (GRCm39) missense possibly damaging 0.94
R7921:Myh8 UTSW 11 67,174,644 (GRCm39) missense probably damaging 0.97
R7926:Myh8 UTSW 11 67,169,732 (GRCm39) missense possibly damaging 0.94
R7932:Myh8 UTSW 11 67,185,430 (GRCm39) missense probably benign 0.00
R8003:Myh8 UTSW 11 67,190,586 (GRCm39) missense probably damaging 1.00
R8028:Myh8 UTSW 11 67,194,502 (GRCm39) missense possibly damaging 0.65
R8121:Myh8 UTSW 11 67,180,647 (GRCm39) missense probably benign 0.00
R8125:Myh8 UTSW 11 67,190,598 (GRCm39) missense possibly damaging 0.94
R8170:Myh8 UTSW 11 67,179,092 (GRCm39) missense probably benign 0.30
R8277:Myh8 UTSW 11 67,183,735 (GRCm39) missense probably benign 0.10
R8304:Myh8 UTSW 11 67,195,162 (GRCm39) missense possibly damaging 0.72
R8431:Myh8 UTSW 11 67,174,440 (GRCm39) missense possibly damaging 0.94
R8535:Myh8 UTSW 11 67,169,741 (GRCm39) missense probably damaging 1.00
R8795:Myh8 UTSW 11 67,174,203 (GRCm39) critical splice acceptor site probably benign
R8858:Myh8 UTSW 11 67,192,820 (GRCm39) missense possibly damaging 0.67
R8927:Myh8 UTSW 11 67,174,081 (GRCm39) missense probably benign 0.10
R8928:Myh8 UTSW 11 67,174,081 (GRCm39) missense probably benign 0.10
R9031:Myh8 UTSW 11 67,190,141 (GRCm39) missense possibly damaging 0.49
R9172:Myh8 UTSW 11 67,183,260 (GRCm39) missense possibly damaging 0.82
R9252:Myh8 UTSW 11 67,177,302 (GRCm39) missense probably damaging 1.00
R9365:Myh8 UTSW 11 67,174,632 (GRCm39) missense probably benign 0.42
R9468:Myh8 UTSW 11 67,197,730 (GRCm39) missense probably damaging 1.00
R9564:Myh8 UTSW 11 67,177,215 (GRCm39) missense probably benign 0.40
R9565:Myh8 UTSW 11 67,177,215 (GRCm39) missense probably benign 0.40
T0722:Myh8 UTSW 11 67,195,262 (GRCm39) missense probably benign 0.41
Z1088:Myh8 UTSW 11 67,189,418 (GRCm39) missense probably damaging 1.00
Z1176:Myh8 UTSW 11 67,194,500 (GRCm39) missense probably damaging 1.00
Z1177:Myh8 UTSW 11 67,199,181 (GRCm39) missense possibly damaging 0.64
Z1177:Myh8 UTSW 11 67,192,250 (GRCm39) missense probably damaging 0.99
Z1187:Myh8 UTSW 11 67,188,312 (GRCm39) missense probably benign
Z1188:Myh8 UTSW 11 67,188,312 (GRCm39) missense probably benign
Z1190:Myh8 UTSW 11 67,188,312 (GRCm39) missense probably benign
Z1191:Myh8 UTSW 11 67,188,312 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TAAGTAGCAGCCATGAGTGCG -3'
(R):5'- AATTGATGAGTTGAATCCTGAGGG -3'

Sequencing Primer
(F):5'- AGCCATGAGTGCGGGTTC -3'
(R):5'- TGAGTTGAATCCTGAGGGAAGTAG -3'
Posted On 2019-05-15