Incidental Mutation 'R7098:Ttll5'
ID550660
Institutional Source Beutler Lab
Gene Symbol Ttll5
Ensembl Gene ENSMUSG00000012609
Gene Nametubulin tyrosine ligase-like family, member 5
SynonymsSTAMP
MMRRC Submission
Accession Numbers

Genbank: NM_001081423

Is this an essential gene? Possibly essential (E-score: 0.547) question?
Stock #R7098 (G1)
Quality Score217.009
Status Validated
Chromosome12
Chromosomal Location85824659-86061893 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to G at 85917673 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000048809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040179] [ENSMUST00000040273] [ENSMUST00000110224] [ENSMUST00000155448] [ENSMUST00000176695] [ENSMUST00000177114]
Predicted Effect probably null
Transcript: ENSMUST00000040179
SMART Domains Protein: ENSMUSP00000048809
Gene: ENSMUSG00000012609

DomainStartEndE-ValueType
Pfam:TTL 110 407 1.9e-94 PFAM
low complexity region 556 575 N/A INTRINSIC
low complexity region 595 621 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 781 793 N/A INTRINSIC
low complexity region 835 847 N/A INTRINSIC
low complexity region 1167 1181 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000040273
SMART Domains Protein: ENSMUSP00000039939
Gene: ENSMUSG00000012609

DomainStartEndE-ValueType
Pfam:TTL 110 407 1e-94 PFAM
low complexity region 556 575 N/A INTRINSIC
low complexity region 595 621 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 781 793 N/A INTRINSIC
low complexity region 835 847 N/A INTRINSIC
low complexity region 1167 1181 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110224
SMART Domains Protein: ENSMUSP00000105853
Gene: ENSMUSG00000012609

DomainStartEndE-ValueType
Pfam:TTL 110 407 1e-94 PFAM
low complexity region 543 562 N/A INTRINSIC
low complexity region 582 608 N/A INTRINSIC
low complexity region 734 748 N/A INTRINSIC
low complexity region 768 780 N/A INTRINSIC
low complexity region 822 834 N/A INTRINSIC
low complexity region 1153 1167 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155448
SMART Domains Protein: ENSMUSP00000134971
Gene: ENSMUSG00000012609

DomainStartEndE-ValueType
Pfam:TTL 110 407 6.4e-95 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000176460
Predicted Effect probably benign
Transcript: ENSMUST00000176695
SMART Domains Protein: ENSMUSP00000135852
Gene: ENSMUSG00000012609

DomainStartEndE-ValueType
Pfam:TTL 110 407 2.1e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177114
SMART Domains Protein: ENSMUSP00000135395
Gene: ENSMUSG00000012609

DomainStartEndE-ValueType
Pfam:TTL 110 407 2.1e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177168
SMART Domains Protein: ENSMUSP00000134874
Gene: ENSMUSG00000012609

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 31 57 N/A INTRINSIC
low complexity region 183 197 N/A INTRINSIC
low complexity region 217 229 N/A INTRINSIC
low complexity region 271 283 N/A INTRINSIC
low complexity region 603 617 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tubulin tyrosine ligase like protein family. This protein interacts with two glucocorticoid receptor coactivators, transcriptional intermediary factor 2 and steroid receptor coactivator 1. This protein may function as a coregulator of glucocorticoid receptor mediated gene induction and repression. This protein may also function as an alpha tubulin polyglutamylase.[provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit male infertility associated with abnormal sperm morphology and reduced tubulin polyglutamylation in the spermatozoa. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, other(3) Gene trapped(4)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik T A 5: 138,646,522 M223K probably benign Het
Abce1 T C 8: 79,686,049 T550A probably benign Het
Acoxl C T 2: 127,854,915 Q28* probably null Het
Adam8 T C 7: 139,979,499 K820R possibly damaging Het
Adamts3 G T 5: 89,861,495 A103D probably damaging Het
Apba2 T A 7: 64,736,948 V441D probably damaging Het
Arap2 A G 5: 62,675,950 probably null Het
Arhgef10l T A 4: 140,580,911 M44L probably benign Het
Asb4 T C 6: 5,398,499 C155R probably damaging Het
Bpifb6 A T 2: 153,906,890 K269* probably null Het
Cc2d2a A T 5: 43,683,139 T161S probably benign Het
Ccdc15 T A 9: 37,343,960 Q98L probably damaging Het
Col19a1 A G 1: 24,526,474 S259P unknown Het
Col5a2 A T 1: 45,380,067 D1284E possibly damaging Het
Cyp2c70 T C 19: 40,180,487 T119A probably benign Het
Dennd6b C T 15: 89,188,687 C188Y probably damaging Het
Dhx8 T A 11: 101,737,768 probably null Het
Dhx9 T C 1: 153,465,022 K624R probably benign Het
Dpys C T 15: 39,793,331 V447M probably damaging Het
E130308A19Rik T C 4: 59,753,004 S706P possibly damaging Het
Esrrb A G 12: 86,470,415 D107G probably benign Het
Fam71d G A 12: 78,719,634 probably null Het
Frmd4a T C 2: 4,572,433 S367P probably damaging Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gm136 T C 4: 34,746,628 I128V probably benign Het
Gm6525 T A 3: 84,175,002 C77S possibly damaging Het
Grid2ip T C 5: 143,357,591 F14S probably damaging Het
Hdhd3 C T 4: 62,499,915 R8H probably damaging Het
Kdelr1 C A 7: 45,874,056 A69D possibly damaging Het
Krtap16-3 T A 16: 88,962,672 Y51F unknown Het
Lrrc40 T A 3: 158,041,639 N129K probably benign Het
Man1b1 T A 2: 25,338,184 D155E probably damaging Het
Mcm5 T C 8: 75,120,901 V442A probably damaging Het
Mfsd14a C T 3: 116,641,712 A235T probably benign Het
Mmp1a C A 9: 7,475,937 T401K probably benign Het
Mpig6b C T 17: 35,064,344 R196Q unknown Het
Mroh1 C T 15: 76,408,457 Q262* probably null Het
Msh3 A T 13: 92,274,111 D656E possibly damaging Het
Muc4 A T 16: 32,757,091 T252S Het
Myh15 C T 16: 49,177,057 A1746V possibly damaging Het
Myh8 C A 11: 67,279,053 T66K probably benign Het
Nemf A T 12: 69,312,467 Y999N probably damaging Het
Neurod1 T C 2: 79,454,685 N118S probably damaging Het
Nlrp1b T A 11: 71,218,274 I134L possibly damaging Het
Nsun7 A T 5: 66,260,983 I19F probably damaging Het
Ofcc1 A G 13: 40,003,966 probably null Het
P2rx7 A G 5: 122,673,793 E389G probably damaging Het
Pam C T 1: 97,898,347 R194H probably benign Het
Pcnt A G 10: 76,384,839 S2052P probably benign Het
Pfkfb4 T A 9: 108,999,154 Y86N probably benign Het
Plcd3 T A 11: 103,077,863 D334V probably damaging Het
Ppard T C 17: 28,298,813 V285A possibly damaging Het
Prune2 A G 19: 17,120,602 S1157G probably benign Het
Psg21 A T 7: 18,652,545 L172H probably damaging Het
Psme4 C A 11: 30,850,661 T1417K probably damaging Het
Ptprc T C 1: 138,099,685 D336G probably benign Het
Ralgapa1 A T 12: 55,790,310 probably null Het
Rap1gap C A 4: 137,716,082 probably null Het
Scap T C 9: 110,372,242 S100P possibly damaging Het
Scpep1 T C 11: 88,929,185 I426V possibly damaging Het
Sdk1 T C 5: 142,096,870 I1341T probably damaging Het
Sfmbt2 T A 2: 10,579,189 Y786N probably benign Het
Sh3tc1 A T 5: 35,702,014 probably null Het
Slc5a5 T A 8: 70,888,538 I386F probably damaging Het
Smarca4 T G 9: 21,634,820 M98R probably benign Het
St18 G A 1: 6,827,842 D623N probably damaging Het
Sult2a1 A T 7: 13,816,053 probably null Het
Tgfb2 C T 1: 186,630,637 R330H probably damaging Het
Thoc3 A G 13: 54,466,306 I168T probably damaging Het
Tmem126a C T 7: 90,450,854 M160I possibly damaging Het
Tmem200b C T 4: 131,922,393 P208L probably benign Het
Tnrc6c T C 11: 117,714,126 V29A probably benign Het
Tsc1 C T 2: 28,675,732 S465F probably benign Het
Unc13d G T 11: 116,063,726 L1019I probably damaging Het
Vmn2r102 A T 17: 19,694,408 H745L probably damaging Het
Wars2 T G 3: 99,216,641 S273A probably damaging Het
Xrcc6 C A 15: 82,035,754 S498* probably null Het
Ybx1 A T 4: 119,282,853 N92K possibly damaging Het
Other mutations in Ttll5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00844:Ttll5 APN 12 85843826 missense probably damaging 1.00
IGL00932:Ttll5 APN 12 85929907 missense probably damaging 1.00
IGL00964:Ttll5 APN 12 85849283 missense possibly damaging 0.78
IGL00978:Ttll5 APN 12 85933482 nonsense probably null
IGL00990:Ttll5 APN 12 85876589 missense probably damaging 1.00
IGL01726:Ttll5 APN 12 85918934 missense probably benign 0.30
IGL01797:Ttll5 APN 12 85956597 missense possibly damaging 0.54
IGL02008:Ttll5 APN 12 85933611 missense probably damaging 1.00
IGL02210:Ttll5 APN 12 85912545 intron probably benign
IGL02979:Ttll5 APN 12 85826582 missense probably damaging 1.00
IGL03079:Ttll5 APN 12 85876558 missense probably damaging 1.00
IGL03149:Ttll5 APN 12 85918984 missense probably damaging 0.98
G4846:Ttll5 UTSW 12 86024244 missense probably damaging 0.99
PIT4812001:Ttll5 UTSW 12 85926861 missense probably benign 0.12
R0045:Ttll5 UTSW 12 85879359 splice site probably benign
R0153:Ttll5 UTSW 12 85831966 missense probably damaging 1.00
R0282:Ttll5 UTSW 12 85996053 missense probably benign 0.12
R0318:Ttll5 UTSW 12 85876594 critical splice donor site probably null
R0465:Ttll5 UTSW 12 85933326 missense probably benign 0.42
R0540:Ttll5 UTSW 12 85933676 critical splice donor site probably null
R1086:Ttll5 UTSW 12 85891079 missense possibly damaging 0.66
R1467:Ttll5 UTSW 12 85918962 splice site probably null
R1470:Ttll5 UTSW 12 85879394 missense possibly damaging 0.59
R1470:Ttll5 UTSW 12 85879394 missense possibly damaging 0.59
R1505:Ttll5 UTSW 12 85879410 missense probably damaging 1.00
R1524:Ttll5 UTSW 12 85864568 nonsense probably null
R1540:Ttll5 UTSW 12 85892208 nonsense probably null
R1598:Ttll5 UTSW 12 85863598 missense probably damaging 0.98
R1649:Ttll5 UTSW 12 85923014 missense probably damaging 1.00
R1774:Ttll5 UTSW 12 85933402 missense probably benign 0.09
R2340:Ttll5 UTSW 12 85892148 missense probably benign 0.02
R4049:Ttll5 UTSW 12 86012799 missense probably benign 0.01
R4094:Ttll5 UTSW 12 85956602 nonsense probably null
R4095:Ttll5 UTSW 12 85956602 nonsense probably null
R4908:Ttll5 UTSW 12 85919174 missense probably benign 0.31
R5012:Ttll5 UTSW 12 85926844 missense possibly damaging 0.93
R5137:Ttll5 UTSW 12 85923045 missense possibly damaging 0.83
R5416:Ttll5 UTSW 12 86012828 missense possibly damaging 0.77
R5773:Ttll5 UTSW 12 85933555 frame shift probably null
R5774:Ttll5 UTSW 12 85933555 frame shift probably null
R6039:Ttll5 UTSW 12 85831955 missense probably damaging 1.00
R6039:Ttll5 UTSW 12 85831955 missense probably damaging 1.00
R6173:Ttll5 UTSW 12 85933377 missense probably damaging 0.99
R6343:Ttll5 UTSW 12 85956699 missense probably benign 0.00
R6449:Ttll5 UTSW 12 86024276 missense probably benign 0.00
R6750:Ttll5 UTSW 12 85956610 missense probably damaging 0.98
R6802:Ttll5 UTSW 12 85879386 missense probably damaging 1.00
R6825:Ttll5 UTSW 12 85883328 intron probably null
R6955:Ttll5 UTSW 12 85864579 missense possibly damaging 0.91
R7154:Ttll5 UTSW 12 85925764 missense probably damaging 0.98
R7215:Ttll5 UTSW 12 85933396 missense probably benign 0.02
R7339:Ttll5 UTSW 12 85857464 critical splice donor site probably null
R7520:Ttll5 UTSW 12 85899471 missense probably damaging 1.00
R7728:Ttll5 UTSW 12 85956632 missense probably benign 0.02
R7894:Ttll5 UTSW 12 85889174 missense probably damaging 1.00
R7977:Ttll5 UTSW 12 85889174 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTTCATGAGGGTTCCCATGAC -3'
(R):5'- TCTGCCAGGACCTAGACTGTAC -3'

Sequencing Primer
(F):5'- GTTCCCATGACAGTCTTGGAGTAAAG -3'
(R):5'- CCAGGACCTAGACTGTACAGTTTG -3'
Posted On2019-05-15